ID: 970504373 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:16712224-16712246 |
| Sequence | CTCAATTTACAAATGGGCAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3283 | |||
| Summary | {0: 2, 1: 24, 2: 233, 3: 766, 4: 2258} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 970504369_970504373 | 18 | Left | 970504369 | 4:16712183-16712205 | CCAGAATATATAAAGAACTCTAA | 0: 5 1: 271 2: 1256 3: 6355 4: 21889 |
||
| Right | 970504373 | 4:16712224-16712246 | CTCAATTTACAAATGGGCAAAGG | 0: 2 1: 24 2: 233 3: 766 4: 2258 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 970504373 | Original CRISPR | CTCAATTTACAAATGGGCAA AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||