ID: 970504373

View in Genome Browser
Species Human (GRCh38)
Location 4:16712224-16712246
Sequence CTCAATTTACAAATGGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3283
Summary {0: 2, 1: 24, 2: 233, 3: 766, 4: 2258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970504369_970504373 18 Left 970504369 4:16712183-16712205 CCAGAATATATAAAGAACTCTAA 0: 5
1: 271
2: 1256
3: 6355
4: 21889
Right 970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG 0: 2
1: 24
2: 233
3: 766
4: 2258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970504373 Original CRISPR CTCAATTTACAAATGGGCAA AGG Intronic
Too many off-targets to display for this crispr