ID: 970505995

View in Genome Browser
Species Human (GRCh38)
Location 4:16731096-16731118
Sequence CCTAGGGAAAGGATGTACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970505989_970505995 -5 Left 970505989 4:16731078-16731100 CCACCAAAAAGAATCAGACCTAG 0: 1
1: 1
2: 3
3: 19
4: 255
Right 970505995 4:16731096-16731118 CCTAGGGAAAGGATGTACATAGG 0: 1
1: 0
2: 1
3: 6
4: 146
970505992_970505995 -8 Left 970505992 4:16731081-16731103 CCAAAAAGAATCAGACCTAGGGA 0: 1
1: 0
2: 2
3: 14
4: 161
Right 970505995 4:16731096-16731118 CCTAGGGAAAGGATGTACATAGG 0: 1
1: 0
2: 1
3: 6
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970505995 Original CRISPR CCTAGGGAAAGGATGTACAT AGG Intronic
900751436 1:4400394-4400416 CCTAGGGGAAGCATGCAGATGGG + Intergenic
900876493 1:5346383-5346405 CCCAGGGAAAGGATGGAACTAGG + Intergenic
909579671 1:77219900-77219922 CCTGGTGAAAGGATTAACATGGG + Intergenic
912118503 1:106438252-106438274 AGTATGTAAAGGATGTACATAGG - Intergenic
916400464 1:164442353-164442375 CCTTGAGAAATGATGTACACTGG + Intergenic
916462953 1:165045841-165045863 CCTAGTAAATGGATGGACATGGG + Intergenic
917361855 1:174185106-174185128 TCTAGGGAAAGGAGGAACCTGGG + Intronic
918217678 1:182407252-182407274 CTTAGGGAGAGGAGGTACAAGGG + Intergenic
921395266 1:214662479-214662501 CCTATGGAAAGAATATAAATGGG + Intronic
1064735758 10:18380348-18380370 CCTATGCAAAGAATGTACTTTGG - Intronic
1066499982 10:35983639-35983661 CTTAGGGAAGGGGTGTACCTGGG - Intergenic
1066627873 10:37427805-37427827 CTTAGGGAAGGGGTGTACCTGGG - Intergenic
1068211681 10:53928163-53928185 CATATAGAAAAGATGTACATAGG - Intronic
1073977595 10:109118394-109118416 CCTAGGGGAAGCATGCAAATGGG - Intergenic
1074415117 10:113260927-113260949 CCTAGGGAAAGGAGGGAAACAGG + Intergenic
1077151294 11:1074268-1074290 CCTGGGAAAAGGATGGGCATAGG + Intergenic
1083517558 11:63274501-63274523 CCTAGGGGAGGGATGTATATAGG - Intronic
1083698115 11:64456089-64456111 CTTGAGGAAAGAATGTACATGGG + Intergenic
1084221520 11:67683377-67683399 CCAAGGGACAGGATGGACCTGGG + Intergenic
1087607660 11:100395876-100395898 CCTAGGGAACTGAGGTACCTAGG - Intergenic
1087967160 11:104430563-104430585 CATAGGGAAAGGAAGCAGATTGG - Intergenic
1087991310 11:104747406-104747428 CCTAGGGGAAGCATGAAGATGGG - Intergenic
1089472471 11:118731949-118731971 CCAAGGTTGAGGATGTACATGGG - Intergenic
1089905433 11:122033176-122033198 CAAAGGGAAAAGATGGACATTGG + Intergenic
1092463597 12:8707938-8707960 CTTCGGGAAAGACTGTACATAGG - Intronic
1096668767 12:53185160-53185182 ACTGGGGAATGGATGAACATTGG + Intronic
1096771407 12:53938396-53938418 CCTAGGCATAGGATGTGCACCGG - Intergenic
1100220372 12:92498428-92498450 CCTAGGGAGAGGAGTTAGATAGG + Intergenic
1100623009 12:96298618-96298640 CATAGGGAAATGTTATACATTGG - Intronic
1102482558 12:113233638-113233660 CCTGGGGAGAGGATGTGCCTGGG + Intronic
1105066540 12:133205051-133205073 CCTAGGGAAAAAATATATATAGG + Intergenic
1105323355 13:19347806-19347828 CATAGGGACAGGATTTACCTTGG + Intergenic
1110469099 13:75838325-75838347 CCTAGGGAAAGAATGGAAATGGG - Intronic
1113153797 13:107294172-107294194 CATAGGGAAAGGAGGGACAAAGG + Intronic
1115429104 14:33295594-33295616 CCTAGGTAAAGCATATAGATTGG + Intronic
1115707958 14:36017462-36017484 CATAGGGACAGGAAATACATTGG + Intergenic
1115727331 14:36231655-36231677 GCTTTGGGAAGGATGTACATGGG + Intergenic
1117079123 14:52133265-52133287 CATAGGGACAGGATGGACATGGG - Intergenic
1117494269 14:56286223-56286245 CCTTGGGAAAGGGAGAACATTGG + Intronic
1121898198 14:97668498-97668520 CCCAAGGAAAAGATGAACATAGG + Intergenic
1122362924 14:101178027-101178049 ACAAGGGGGAGGATGTACATGGG - Intergenic
1125205502 15:37149687-37149709 CCTGGGGAAGGGATGTAACTTGG - Intergenic
1126168191 15:45671668-45671690 ACTAGGGCAAGGATGTAGCTGGG + Intronic
1128245335 15:66128827-66128849 AGTAGGGAAAGGAAGTAGATGGG - Intronic
1129686904 15:77691480-77691502 CCTAGGGAAGGGATGTCCCTGGG + Intronic
1129686911 15:77691497-77691519 CCTGGGGAAGGGATGTCCCTGGG + Intronic
1137483110 16:48868887-48868909 CCTAGGGAAAGCAGGATCATGGG - Intergenic
1138724735 16:59123597-59123619 CCTAAGGAAGGGAGTTACATAGG + Intergenic
1140868658 16:79087002-79087024 CCTAGGGAATGGAGATACCTGGG + Intronic
1147414022 17:40275472-40275494 CCTAAGTAAAGGTTGTCCATAGG + Intronic
1148348424 17:46920443-46920465 TTTAGGAAAAGAATGTACATGGG + Intergenic
1148682580 17:49483138-49483160 CCTGGGGACAGGATGTAGATGGG + Intergenic
1150109894 17:62489702-62489724 ACTAGGGTAAGGAAGTATATGGG - Intronic
1150855196 17:68745599-68745621 CCTAGGGGAAGCATGAAGATGGG - Intergenic
1151119275 17:71773993-71774015 GCAAGGGAGAGGATGTACAGGGG - Intergenic
1151167948 17:72220539-72220561 CCTAGTGCTAGGATTTACATCGG - Intergenic
1151421227 17:73999262-73999284 CCTAGGGAATGGTTGTAAAAAGG - Intergenic
1153603786 18:6810339-6810361 CCCAGGGAAAGCATGAACAAAGG + Intronic
1163866032 19:19774238-19774260 CCACTGGAAAGGATGAACATGGG + Intergenic
928523324 2:32113488-32113510 ATTAGGGATAGGATGTACAGAGG - Intronic
930110969 2:47678175-47678197 CCCAGGGAAAGGGTGTAAAGGGG + Intergenic
930562933 2:52983300-52983322 GCTGTGGAAAGGATTTACATGGG + Intergenic
931203945 2:60128735-60128757 GGTAGGTAAAGCATGTACATAGG - Intergenic
932030249 2:68176645-68176667 CCTGGGGAAAGGATGAAGGTAGG - Intronic
935388411 2:102525142-102525164 CCTGGGGAAAGCCGGTACATTGG + Exonic
937112753 2:119379102-119379124 CCAAGGGACAGAATGGACATGGG - Intergenic
939130362 2:138228413-138228435 CATGGGGAGAGGAAGTACATTGG - Intergenic
941369865 2:164651686-164651708 CCAAGGGAGAAGCTGTACATTGG + Intergenic
942853970 2:180524191-180524213 CCTAGGGAATGGGTGGACCTGGG + Intergenic
943631928 2:190263523-190263545 CCTAGGGAATGCATGTAGACAGG - Intronic
946382246 2:219356981-219357003 CATAGAGATAGGAAGTACATTGG + Intergenic
948708714 2:239811967-239811989 CCTCGTGAAAGGAGGTACAAAGG - Intergenic
1168922296 20:1550265-1550287 GCTAGGGAGAGGAGGTCCATGGG - Intronic
1170546573 20:17439918-17439940 CCCAGGGGAAGGAAGCACATAGG + Intronic
1170551821 20:17483471-17483493 TCTTGGGAATGGATGTGCATTGG - Exonic
1177444207 21:21170562-21170584 GCAAGGGAAAGGATGAACAAGGG + Intronic
1180800230 22:18628298-18628320 CCTAGGGACAGGATGTGCGCAGG + Intergenic
1180895921 22:19331957-19331979 CCCAGGGCAAGGATGCACCTGGG + Intronic
1180999657 22:19982091-19982113 CCTGGGGCAAGGAGGGACATTGG + Exonic
1181221486 22:21366968-21366990 CCTAGGGACAGGATGTGCGCAGG - Intergenic
1182444877 22:30384291-30384313 CCTAGGGAAAGGAGGCTCGTGGG - Intronic
1182493425 22:30689542-30689564 CCTAGGAAAAGGAGGTGAATTGG - Intergenic
1183317817 22:37146515-37146537 CCCAGGGAAAGGATAGACTTGGG - Intronic
951189000 3:19747643-19747665 CCTAGGGAGAGAATGTAGACAGG + Intergenic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
952838866 3:37627646-37627668 CCTAGGGAACTGAGGTTCATAGG + Intronic
953200946 3:40778085-40778107 TCTAGGGAAAGGATGGAGATAGG - Intergenic
953749624 3:45599360-45599382 CATAGGGACAGAATGCACATTGG - Intronic
954533882 3:51343615-51343637 CCAAAGGAAAAGATGTAGATGGG + Intronic
956602286 3:71034791-71034813 CCTAAGGAAAGGAAGCAAATGGG + Intronic
961339152 3:126205509-126205531 CCTGGGGAGAGGGTGTACCTAGG + Intergenic
961339182 3:126205626-126205648 CCTAGGGAAAGGGTGTACCTAGG + Intergenic
961339200 3:126205677-126205699 CCTGGGGAAAGGGTATACCTGGG + Intergenic
964827029 3:160839865-160839887 CCTAGGGAAAGGCTTTCCAACGG - Intronic
965754406 3:172010837-172010859 CCTAGGGAAGTGTAGTACATTGG - Intergenic
966216013 3:177503422-177503444 GCTTTGGCAAGGATGTACATGGG + Intergenic
966609648 3:181855604-181855626 ACTAGGGAAAGGATGAGAATCGG - Intergenic
967731050 3:192907264-192907286 CCTAGGGAATGAATGTCTATAGG + Intronic
970109137 4:12617907-12617929 CAGAGAGGAAGGATGTACATGGG + Intergenic
970505995 4:16731096-16731118 CCTAGGGAAAGGATGTACATAGG + Intronic
971013953 4:22468322-22468344 CCTAGGGGTAGGATTAACATTGG + Intronic
971040943 4:22751443-22751465 CCTGTGGTAAGCATGTACATGGG - Intergenic
983352510 4:166609997-166610019 CCAAGGTAAACTATGTACATTGG + Intergenic
985136881 4:186794904-186794926 CCTAGGGAAAGGAACTGCAACGG - Intergenic
985854900 5:2417112-2417134 CCTAGGGGGAGGGTGCACATGGG - Intergenic
985961684 5:3307441-3307463 CCCAGGGGAAGGGTGTACTTGGG - Intergenic
989230619 5:39082240-39082262 ACTAGAGAAAGCATGGACATTGG + Intergenic
989491495 5:42060593-42060615 CCTAGGGGAAGCATGCAGATGGG - Intergenic
993350556 5:86844819-86844841 CCTAAGTAAAGGAAGGACATGGG - Intergenic
995976045 5:118035729-118035751 CCTATGGAAATGATTTACAAGGG - Intergenic
997498733 5:134353962-134353984 GCTAGGGAAAGGAGGTTAATAGG - Intronic
998030115 5:138859364-138859386 CCAAGGGAATGGGTGTAGATGGG - Intronic
1001176297 5:169471870-169471892 CCTAGGGAAAGGATTCTGATTGG - Intergenic
1001223292 5:169921990-169922012 CCCAGGACCAGGATGTACATGGG - Intronic
1002600433 5:180351632-180351654 CCTAGGGAAAGGTTGAGCTTTGG - Intronic
1003455124 6:6275005-6275027 CCTAGGGAGGGGATGGAGATGGG + Intronic
1008399635 6:51049677-51049699 CCTAGGAAGAGGAGGTACCTGGG + Intergenic
1011890677 6:92155638-92155660 CCTGTGAAAAGGATGTCCATAGG + Intergenic
1014087864 6:117368406-117368428 TAAAGGGAATGGATGTACATAGG + Intronic
1014620405 6:123660555-123660577 CCTAGGGGAAGCATGCAGATGGG + Intergenic
1015129482 6:129793484-129793506 CCTAGGGAGAGGGTGTAGAATGG + Intergenic
1020471096 7:8535934-8535956 CCTAGGCAAAGGAGATACCTGGG - Intronic
1021146836 7:17099603-17099625 CTCAGGGAGAGGATTTACATGGG - Intergenic
1022492512 7:30831762-30831784 CCAAGGGGAATGATGTTCATAGG - Intronic
1023175470 7:37431688-37431710 CCTGGTAAAAGGTTGTACATAGG - Intronic
1023639512 7:42243181-42243203 GCAAGGGAAAGGAAGGACATAGG + Intergenic
1026248459 7:68645228-68645250 CCTAGGGAGAGCATGCAGATGGG - Intergenic
1026403509 7:70040295-70040317 TGTAGGGACAGGAAGTACATGGG + Intronic
1030776834 7:113543901-113543923 ACTAGGAAAAAGATGTTCATGGG - Intergenic
1032890385 7:136189066-136189088 CCTAGAGAAAGAATGTAGAAAGG + Intergenic
1033000871 7:137502951-137502973 ACTAGGGAAAGGCTGTAAACAGG + Intronic
1033483260 7:141762450-141762472 CCTAAGCAAAGGAGGTAGATGGG + Intronic
1035988810 8:4465007-4465029 CCTTGGGAAAGGAAGAAAATAGG + Intronic
1037076812 8:14730712-14730734 CCTAGGGAATGGAGGTGCCTTGG - Intronic
1044426548 8:92058040-92058062 CATAGGGGAAGGATGCACAATGG - Intronic
1047303382 8:123634138-123634160 CCTTGGGAAAGAATGTACCAAGG - Intergenic
1048063333 8:130943228-130943250 CCTAGGGACAGGATGCAGAATGG + Intronic
1048361445 8:133700545-133700567 CCTGGGAAAAGAATTTACATTGG + Intergenic
1050495536 9:6237681-6237703 CCTAGAGATAGAATGTAGATTGG + Intronic
1051506905 9:17837565-17837587 CCCTGGGGAAGGATGGACATGGG - Intergenic
1052566488 9:30160226-30160248 CCTAGGGGAAGCATGCAGATGGG + Intergenic
1060323165 9:122585014-122585036 CATAGGGAAAGAAAGTAGATGGG + Intergenic
1187138568 X:16571445-16571467 CCTAGGGGAAGCATGCAGATGGG - Intergenic
1187381261 X:18804103-18804125 CTTAGGGGAAGGATGTTTATGGG - Intronic
1187885338 X:23883809-23883831 CCTAGGGAAAGCAGGCAGATGGG - Intronic
1188904174 X:35772539-35772561 CCAAGGGACAGGATGGACCTGGG - Intergenic
1191200922 X:57780353-57780375 CTGAGGGACAGGATGGACATGGG - Intergenic
1191927291 X:66327247-66327269 ACCAGGGAAAGGATGTGGATGGG + Intergenic
1192796356 X:74426851-74426873 CGTGGGGAAATGATGTATATAGG - Intronic
1196966447 X:121061505-121061527 CCCACTGAAAGGATGTATATTGG - Intergenic
1198622136 X:138524719-138524741 CCTTGGGAAAAGATGTATTTGGG + Intergenic
1198982816 X:142418804-142418826 CCAAGGGACAGGATGGACCTAGG + Intergenic
1199367308 X:147002326-147002348 CCGAGGGACAGAATGGACATGGG + Intergenic
1199651774 X:149952007-149952029 CCAAGGGACAGGATGGACCTGGG - Intergenic