ID: 970507962

View in Genome Browser
Species Human (GRCh38)
Location 4:16752040-16752062
Sequence GCGAATAAATGCATGGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970507956_970507962 -4 Left 970507956 4:16752021-16752043 CCATTTAATGGAACCCCATGCGA 0: 1
1: 0
2: 0
3: 2
4: 52
Right 970507962 4:16752040-16752062 GCGAATAAATGCATGGTCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 65
970507955_970507962 7 Left 970507955 4:16752010-16752032 CCATCTGGAAACCATTTAATGGA 0: 1
1: 0
2: 1
3: 11
4: 168
Right 970507962 4:16752040-16752062 GCGAATAAATGCATGGTCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970507962 Original CRISPR GCGAATAAATGCATGGTCCA GGG Intronic
900689349 1:3970835-3970857 TGGAACAAAGGCATGGTCCATGG - Intergenic
911385607 1:97171172-97171194 GCCAATAAACGGAAGGTCCATGG + Intronic
912195012 1:107387537-107387559 GCTAATCAATGTGTGGTCCATGG - Intronic
913239261 1:116815012-116815034 GAAAATGAATGCATGTTCCAAGG + Intergenic
914847015 1:151289018-151289040 GAGAATAAATGTATGGTCCCGGG + Intronic
915509855 1:156380843-156380865 GCACATAAATGCATAGCCCATGG - Intronic
923472108 1:234300877-234300899 GAGAATAAGGGCATGGGCCAGGG + Intronic
1067899590 10:50225162-50225184 GGGACTAAAGGCATGGTGCAAGG - Intronic
1074448950 10:113543347-113543369 GTGAATAAATGCATGACTCAGGG + Intergenic
1082655542 11:55852164-55852186 GTGAATAAAAGCAAGGTCCCTGG - Intergenic
1086160033 11:83711762-83711784 GCTAATCAAAGCATGCTCCATGG + Intronic
1087402563 11:97685701-97685723 TGAAATAAATGCATAGTCCAAGG - Intergenic
1092005550 12:5066888-5066910 GCTAATAAATGGATGCACCAAGG + Intergenic
1092042811 12:5400097-5400119 GAGAAAAAGTGCCTGGTCCATGG - Intergenic
1094175205 12:27534159-27534181 AGGAATGAGTGCATGGTCCAGGG + Intronic
1117419712 14:55532173-55532195 GTGAATAAATGAATGGTTCTTGG - Intergenic
1202878612 14_KI270722v1_random:35072-35094 GAGAATAAATTCATGTTCAAAGG + Intergenic
1133326037 16:4943023-4943045 GGGAATACAGGCATGGGCCACGG + Intronic
1135576967 16:23593601-23593623 GCCATTCAAAGCATGGTCCAAGG + Intronic
1137368314 16:47880279-47880301 GTGAAAAAATTCATGCTCCATGG - Intergenic
1139259499 16:65578187-65578209 GCTACTCAAAGCATGGTCCACGG + Intergenic
1144285311 17:13768943-13768965 ACAAATAAATACATGGTCAAGGG - Intergenic
1147963801 17:44182338-44182360 GCAAATAAATGATTAGTCCATGG + Intergenic
1150150380 17:62804095-62804117 GCGATTATATGAATGGACCAGGG + Intronic
1157711478 18:49852699-49852721 GAGAAGAAAAGCATGGACCAAGG - Intronic
1158677436 18:59533717-59533739 GTGAATTAATGCATGGTACAGGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1202654233 1_KI270708v1_random:4120-4142 GAGAATAAATTCATGTTCAAAGG + Intergenic
927088715 2:19694422-19694444 CCTCATAAATGAATGGTCCAAGG + Intergenic
933688639 2:85162316-85162338 TTGAATAAATGTATGTTCCAGGG - Intronic
940143533 2:150521960-150521982 CCCATTAAATGCATGGTCTATGG + Intronic
942325820 2:174776370-174776392 GCGGATGAATGCATCCTCCAGGG - Intergenic
943319994 2:186434216-186434238 GTCAATAAATCCAAGGTCCAAGG + Intergenic
1171177727 20:23066141-23066163 GACAATAAATACATAGTCCATGG + Intergenic
1173684691 20:44914881-44914903 GAGAATAAATGACTTGTCCAAGG - Intronic
1174715779 20:52757038-52757060 GAGAACAAATGCATGTTCTAAGG + Intergenic
1180389264 22:12210304-12210326 GAGAATAAATTCATGTTCAAAGG - Intergenic
1180416675 22:12724172-12724194 GAGAATAAATTCATGTTCAAAGG + Intergenic
1184292822 22:43507225-43507247 ACAAAGCAATGCATGGTCCAAGG + Exonic
950716455 3:14850886-14850908 GCAAATGTATGCATGGGCCAGGG + Intronic
954506711 3:51082683-51082705 GCACATAAGTGCATAGTCCAAGG + Intronic
965624281 3:170671576-170671598 GTGAATAAATGAATGGACTAAGG + Intronic
970507962 4:16752040-16752062 GCGAATAAATGCATGGTCCAGGG + Intronic
977901395 4:102426154-102426176 GGGAAAAAATGCATGTTCTAAGG - Intronic
979323797 4:119355159-119355181 GTGAATAAATGCATGGAAAATGG - Intergenic
981639584 4:146925222-146925244 GTGATTAAAGGCATTGTCCAAGG + Intronic
988354891 5:30161209-30161231 GCAAATGAAGGCATGGTCCATGG - Intergenic
990454329 5:55970388-55970410 AAGAATAAATGCATGGCCCTGGG + Intronic
990818387 5:59810588-59810610 GGGAGCAAATGCATGGTCCAAGG - Intronic
992495428 5:77288528-77288550 GAGAATAAATAAATTGTCCAGGG + Intronic
998917642 5:147033192-147033214 GCCAATAAATGTTTGGTCCTGGG + Intronic
1000322710 5:160147652-160147674 GGGATTAAATGCATGAGCCACGG + Intergenic
1017665380 6:156715328-156715350 ACAAATAAATAAATGGTCCATGG - Intergenic
1026681752 7:72472290-72472312 GTGGATGAATGCATGGTCAATGG + Intergenic
1027736825 7:81942900-81942922 AAGAATAAATGCATGTTTCATGG + Intergenic
1041262552 8:56034429-56034451 GCTAATAAAAGCATGGGCAATGG + Intergenic
1043855762 8:85262947-85262969 GCAAATAAATAAATGGTGCATGG + Intronic
1046140985 8:110091713-110091735 GCTACTAAAAGCGTGGTCCATGG + Intergenic
1052339943 9:27355058-27355080 GTTAGTAAATGCAGGGTCCAGGG + Intronic
1052609894 9:30758859-30758881 GTAAATAAATGGACGGTCCATGG - Intergenic
1056201466 9:84280981-84281003 ACAAATAAATGCACAGTCCATGG + Intronic
1056599095 9:88032138-88032160 GGGATTATAAGCATGGTCCATGG - Intergenic
1057273258 9:93662572-93662594 ATGAACAAATGCATGGTGCATGG + Intronic
1061677116 9:132223726-132223748 GCGAATAGAGGCCTGGACCAGGG - Intronic
1062247979 9:135579411-135579433 GTGAATAAATGGATGGTGTATGG - Intergenic
1187211484 X:17236695-17236717 GAGAATAGATGCATGGAGCATGG - Intergenic
1194620994 X:96171660-96171682 GTGAATAAATGTATGATCAAAGG + Intergenic
1195695488 X:107663854-107663876 GAAAAAAAAAGCATGGTCCAGGG - Intergenic
1196763818 X:119224669-119224691 GCAAATAAATGCAGAGTTCAAGG + Intergenic
1201169840 Y:11247542-11247564 GAGAATAAATTCATGTTCAAAGG - Intergenic