ID: 970509669

View in Genome Browser
Species Human (GRCh38)
Location 4:16768935-16768957
Sequence CACGAAAGAGTTCAACCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970509669 Original CRISPR CACGAAAGAGTTCAACCCCA AGG Intronic
903009046 1:20317602-20317624 CACCGAAGTGTCCAACCCCATGG + Exonic
919676828 1:200392315-200392337 CTCGAAAGAGCTCAAGCCCAGGG - Intergenic
924023664 1:239810737-239810759 AACTAAATAGTTCAACCTCATGG - Intronic
924446736 1:244139941-244139963 AACGAAGCAGTTCAACCCCTCGG + Intergenic
1072423202 10:95307041-95307063 CTCAAAGGAGTTCAGCCCCAGGG - Intergenic
1079092312 11:17489584-17489606 CACCAAGTAGTGCAACCCCAGGG - Intergenic
1091784033 12:3231564-3231586 CCCTAAAGAGGTCAACCTCAAGG + Intronic
1100039164 12:90291453-90291475 CACCAAAGAGTGCAACTACAGGG - Intergenic
1103308656 12:119988007-119988029 CACCAACGAGGTCAACACCAAGG + Intergenic
1105024008 12:132836769-132836791 CGGGAAAGATTTCAAGCCCAGGG + Intronic
1118650396 14:67886131-67886153 CAAGAAAGACTTCAACCAAAAGG - Intronic
1122480233 14:102042486-102042508 CACCATGGAGATCAACCCCAAGG + Exonic
1125011636 15:34883169-34883191 CATGAAAGAGATGAAACCCAAGG + Intronic
1129672333 15:77614200-77614222 CAGGAAAGAGATGAAGCCCATGG + Exonic
1129810822 15:78508209-78508231 CACGGGGCAGTTCAACCCCAAGG - Intronic
1131767019 15:95688692-95688714 GGCTAAGGAGTTCAACCCCATGG + Intergenic
1136574028 16:31112634-31112656 CACGAACCAGTTCAACCCAAGGG - Intronic
1144724326 17:17494174-17494196 CTAGAAAGAGTTCATCTCCAGGG + Intergenic
1149453144 17:56765957-56765979 CGCCAAAGAGACCAACCCCAGGG + Intergenic
1150583754 17:66498950-66498972 CAGGAAAGAGTTTAACCTTAAGG + Intronic
1154037239 18:10814911-10814933 GAGGAAAGAGTTCAACCTTACGG + Intronic
1157142521 18:45124238-45124260 AATGAAAGAGTTTAAACCCAGGG + Intergenic
925170675 2:1748464-1748486 CCCTGGAGAGTTCAACCCCATGG - Intergenic
929042405 2:37758333-37758355 CAGGAAAAAGTCTAACCCCATGG - Intergenic
932813281 2:74841991-74842013 AAAGCCAGAGTTCAACCCCAGGG - Intronic
934815091 2:97317963-97317985 CCGGAAGGAGTTAAACCCCATGG + Intergenic
934822604 2:97390520-97390542 CCGGAAGGAGTTAAACCCCATGG - Intergenic
934882788 2:97997837-97997859 CACGGAAGAGATCAAACCCAAGG + Intergenic
935939880 2:108227123-108227145 CAGCCAAGAGTTGAACCCCAAGG - Intergenic
938705710 2:133923728-133923750 CAAGAAGGAGATAAACCCCAAGG + Intergenic
939916013 2:148044340-148044362 TACTAAATAGTTCAGCCCCATGG - Intronic
940966818 2:159847405-159847427 CACTACAGACTTGAACCCCAGGG + Intronic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
1203294596 22_KI270736v1_random:29824-29846 CAGGAAAAAGTTTAGCCCCATGG - Intergenic
952888904 3:38028550-38028572 CACTAAAGCCTCCAACCCCAAGG + Intronic
957910765 3:86618210-86618232 AACGAAAGAGTTCTACACCCTGG + Intergenic
970509669 4:16768935-16768957 CACGAAAGAGTTCAACCCCAAGG + Intronic
974833585 4:67219083-67219105 CACAAAAGAGTTCAACTCTGAGG + Intergenic
975030043 4:69603625-69603647 CAGGAAGAAGTTCAAACCCATGG + Intronic
986243625 5:5984620-5984642 CACCAAAGAGTTTTACCTCAAGG + Intergenic
987838927 5:23197912-23197934 GAAGAAAGAATTCAACCACAGGG + Intergenic
989319073 5:40114038-40114060 CAGGAATGAGTTCTCCCCCAGGG + Intergenic
992416026 5:76552046-76552068 AACGAAAGTGTTCAGGCCCAGGG - Intronic
1003504069 6:6725466-6725488 CACCAAGGGGTTCCACCCCAAGG + Intergenic
1015447125 6:133319177-133319199 GAGGGAAGAATTCAACCCCAGGG + Intronic
1029618428 7:101674791-101674813 CACGAAAGAGTTCAATCATTTGG - Intergenic
1034467416 7:151238254-151238276 CACCACAGAGATCACCCCCAGGG + Exonic
1036094231 8:5705705-5705727 GATGAAAGAGTTGAACCTCAGGG - Intergenic
1039740152 8:40375362-40375384 CACAATAGAGATCAAGCCCATGG + Intergenic
1039828829 8:41196633-41196655 CACGAAAGAATGCAAGCCCCTGG - Intergenic
1047541963 8:125776614-125776636 AATGAAAAAGTTAAACCCCAGGG + Intergenic
1050693590 9:8255801-8255823 CACTAAAGAGTTGAAAACCAAGG - Intergenic
1052378858 9:27747778-27747800 CAAGATAGAGTAAAACCCCAGGG - Intergenic
1057858654 9:98622711-98622733 CATCAAAGAGTACCACCCCAGGG - Intronic
1062113720 9:134796572-134796594 TACGGAAGAGTTCACTCCCAGGG - Intronic
1200923761 Y:8636045-8636067 CCTGAAAGAGTGCAACACCAGGG - Intergenic