ID: 970516492

View in Genome Browser
Species Human (GRCh38)
Location 4:16836238-16836260
Sequence TTGAGATTCTTCAAATGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970516492_970516493 -7 Left 970516492 4:16836238-16836260 CCTCAACATTTGAAGAATCTCAA 0: 1
1: 0
2: 0
3: 19
4: 228
Right 970516493 4:16836254-16836276 ATCTCAAATTATTGAGCTTGTGG 0: 1
1: 0
2: 4
3: 18
4: 222
970516492_970516494 -6 Left 970516492 4:16836238-16836260 CCTCAACATTTGAAGAATCTCAA 0: 1
1: 0
2: 0
3: 19
4: 228
Right 970516494 4:16836255-16836277 TCTCAAATTATTGAGCTTGTGGG 0: 1
1: 0
2: 0
3: 21
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970516492 Original CRISPR TTGAGATTCTTCAAATGTTG AGG (reversed) Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
907475566 1:54703084-54703106 TTAAGATTGATCAAATGTGGAGG - Intronic
909457202 1:75863031-75863053 TATAAATTTTTCAAATGTTGGGG - Intronic
911456044 1:98124992-98125014 TTGAGATTCTTCATCTGCAGAGG + Intergenic
911930521 1:103897055-103897077 TTGACATTCTTTAAATTTAGAGG - Intergenic
912971090 1:114284096-114284118 TTGAGATTCCTGAAATCTTGTGG + Intergenic
915141581 1:153771590-153771612 GTGAGATTCTTCACTTGCTGTGG - Intronic
915424611 1:155814498-155814520 TTGAGATACTTCAGACTTTGTGG - Intronic
915845677 1:159262026-159262048 TTGAGATTATGAAAATGTTATGG + Intergenic
917796905 1:178539185-178539207 TTGGGATTCTTCTTCTGTTGGGG - Intronic
917996107 1:180439859-180439881 TGCAGGTTCTTCACATGTTGAGG + Intronic
919520849 1:198584519-198584541 TTGAGACTCTTCAATTCTTTTGG + Intergenic
921025575 1:211277708-211277730 TTGAGATTATGAAAATGTTCTGG + Intronic
921705701 1:218320513-218320535 TTAAGATAATTTAAATGTTGAGG + Intronic
923642317 1:235777142-235777164 TGGAGATTCTTTAGATGATGAGG + Exonic
923941001 1:238827283-238827305 TTGACATTTTTCAGATGATGGGG - Intergenic
924469574 1:244329569-244329591 TTTACATGCTTCAATTGTTGGGG + Intergenic
1063102023 10:2958687-2958709 TTGAAATGTTTCAAATATTGGGG - Intergenic
1065038679 10:21667345-21667367 TTGAGGTTCTTAAACTGTGGGGG + Intronic
1065505355 10:26425053-26425075 TTGAGATTTTTCTTATGTAGAGG - Intergenic
1066251410 10:33636858-33636880 TTGTGATTATTGAAAAGTTGAGG - Intergenic
1066305229 10:34133731-34133753 TTGAGATTCTTCAAAATATGTGG - Intronic
1066571961 10:36783470-36783492 TTTAAATTCTTCAAATGTATTGG - Intergenic
1067174548 10:43934360-43934382 TAGAGATTTTGCAAATGTTATGG - Intergenic
1068525535 10:58125132-58125154 TTGAGATTATGAAAATGTTCTGG + Intergenic
1073307711 10:102516071-102516093 TTGTGAATTTTTAAATGTTGAGG + Intronic
1073837303 10:107459236-107459258 TTGAGATTCTGGAATTGGTGTGG + Intergenic
1073998195 10:109339772-109339794 TTGAAATTCTACCACTGTTGAGG - Intergenic
1074006989 10:109436662-109436684 TTGAAATTCTTCATACGTTTTGG - Intergenic
1079338373 11:19591096-19591118 TTAATATTTTTCTAATGTTGAGG + Intronic
1088144185 11:106654331-106654353 TTAACATTCTTCATATGTTTGGG + Intergenic
1089373933 11:117980965-117980987 GTGAAATACTTCACATGTTGTGG - Intergenic
1091532873 12:1376333-1376355 TTGACATTTTCCTAATGTTGAGG - Intronic
1092152012 12:6255722-6255744 TTTAAATTTTTTAAATGTTGAGG + Intergenic
1093235106 12:16600444-16600466 TTGAAATACTTTAAATATTGTGG + Intronic
1096115388 12:49052024-49052046 AGGAGATTCTTCAAATGGTGGGG + Exonic
1096276980 12:50217866-50217888 TTGAAATGCTTGAAATGTAGAGG - Intronic
1096610674 12:52799260-52799282 TTCAGATAATTCAAGTGTTGGGG - Intergenic
1098241940 12:68477018-68477040 TTGAGATCTTTCAAGTCTTGGGG - Intergenic
1099021907 12:77416798-77416820 TTGAAAGGCTTCAAATGTTGAGG - Intergenic
1099842346 12:87981777-87981799 TTGAGATTTTTCAAGTGCTAAGG - Intronic
1100830573 12:98513406-98513428 TTGAGTTTTTTTAAGTGTTGGGG + Intergenic
1104107464 12:125676863-125676885 TTGAGAATCTGGACATGTTGTGG - Intergenic
1107142700 13:37019218-37019240 TTTAGATTCTTCTAAGGGTGTGG - Intronic
1109494620 13:63152057-63152079 TTGACATTCTCAAAATGTTATGG - Intergenic
1109540696 13:63775413-63775435 TTGGGATTCTTCAACTGAGGTGG - Intergenic
1110959470 13:81603202-81603224 TTGAGATTCTGAAAATAATGTGG - Intergenic
1111897816 13:94162789-94162811 TTGTGATTCTTCATTTGTTCAGG + Intronic
1115932711 14:38515059-38515081 TTGAGATTAATTGAATGTTGAGG - Intergenic
1116089562 14:40287563-40287585 CTCAGATTCATCAAATGTTGGGG - Intergenic
1116140113 14:40982604-40982626 TACAGTTTCATCAAATGTTGGGG + Intergenic
1116423556 14:44762409-44762431 TTGCCATTCCTCAAATGTTAGGG + Intergenic
1117542796 14:56764761-56764783 TTGAGAATCTTAAAAATTTGGGG + Intergenic
1118866766 14:69710539-69710561 TTCAGCTTCTTCATATGCTGTGG - Intronic
1118889675 14:69898077-69898099 GTGAAATACTTAAAATGTTGAGG - Intronic
1119063305 14:71498979-71499001 TTCAGATTCTTCAAATGATAGGG + Intronic
1125059817 15:35405913-35405935 TTGAAGTTTATCAAATGTTGAGG + Intronic
1126273331 15:46847800-46847822 TTGAGGTTCTTCTATTCTTGTGG + Intergenic
1127247208 15:57190245-57190267 TTGAGCTTTTTAAAAAGTTGAGG - Intronic
1129137005 15:73562953-73562975 TTGATATACTTAAAATGTGGGGG - Intronic
1129572969 15:76709511-76709533 TTGAGATTTTTCACATCTTCTGG - Intronic
1131006178 15:88980353-88980375 CTGACATTATTCACATGTTGAGG + Intergenic
1131710012 15:95043376-95043398 TTGTGATTCTTCACTTGCTGCGG - Intergenic
1136021616 16:27444185-27444207 TTGGAATTCTTCAACAGTTGAGG - Intronic
1137319076 16:47360191-47360213 TTGATATTCTTCAAATTGTATGG - Intronic
1137341900 16:47615646-47615668 TTGCCATTCTTCAAGTGCTGAGG + Intronic
1138390200 16:56664832-56664854 TTATGAGTGTTCAAATGTTGGGG + Intronic
1138395390 16:56700364-56700386 TTGAGATGATGCAAATGTTCTGG + Intronic
1139174969 16:64675891-64675913 TTAAGATTTTGCAAATGATGTGG + Intergenic
1140193876 16:72840666-72840688 TAGAGATTCTTCAGACGCTGTGG - Intronic
1145376355 17:22352343-22352365 TTGAGATTCTTTAATTGTATGGG - Intergenic
1147275630 17:39314033-39314055 TTGAGATTGTTGAAATGTTCTGG - Intronic
1147898562 17:43768739-43768761 TTGTAATTCTCCAAATGGTGGGG + Exonic
1149926755 17:60708981-60709003 TTGATATTATTTAAATGGTGTGG + Intronic
1150061713 17:62074314-62074336 TTGATATAGATCAAATGTTGTGG + Intergenic
1153067978 18:1068901-1068923 TTGTGATTACTCAAATGTTTGGG + Intergenic
1153128244 18:1822498-1822520 TTTGCATTCTTCAAATGTTTTGG - Intergenic
1155821358 18:30381689-30381711 TTGAGAGTTTTCAAATATTTTGG - Intergenic
1155907973 18:31475407-31475429 TCTAGATTCTACAAATCTTGTGG - Intronic
1156725751 18:40124353-40124375 AAGTGATTCTACAAATGTTGTGG + Intergenic
1156779354 18:40832544-40832566 TTTAGACTGTTGAAATGTTGTGG - Intergenic
1157732394 18:50015490-50015512 TTGGGATTTTACAAATGTTAAGG - Intronic
1164515048 19:28927168-28927190 TAGAGATTTTTTAAATTTTGTGG - Intergenic
927537934 2:23878799-23878821 TTGAGATTCCTTATATGTTCTGG - Intronic
928090713 2:28373048-28373070 TTGACAGTCTTCAAAAGTTTGGG - Intergenic
929240686 2:39650259-39650281 TTGAGAATCTTGAAATGGGGAGG - Intergenic
929373972 2:41261458-41261480 TTGTGACTCTTCAAATCTTGGGG - Intergenic
929723179 2:44393352-44393374 TTGAATTTCTTCGAATGTTGTGG + Intronic
930146063 2:48005810-48005832 TTTGGGTTCTTCAAATTTTGGGG + Intergenic
930923014 2:56780504-56780526 TTGAGCTTCTTAAAATTCTGGGG - Intergenic
931422404 2:62140497-62140519 TTGCGATTTTTCAAATTTTGAGG - Intronic
933308221 2:80628825-80628847 TTCAGATTCCTCATATGATGGGG - Intronic
934136901 2:89004724-89004746 TGGAGATTCCTCACATTTTGGGG - Intergenic
935304840 2:101727556-101727578 TTTAGACTCTTAAAATTTTGGGG + Intronic
935834803 2:107038578-107038600 TTGACATTCTTGAAAGGCTGAGG + Intergenic
936684805 2:114815302-114815324 TGGGCATTCTTCAGATGTTGAGG - Intronic
937605228 2:123792594-123792616 TAGAGATTCTTGAAAAGTCGGGG + Intergenic
940663476 2:156576521-156576543 TTGAAATTCTTCCAGTTTTGGGG - Intronic
940695572 2:156973414-156973436 AAGATTTTCTTCAAATGTTGAGG + Intergenic
941007636 2:160263801-160263823 ATGAGATGCTTCAACTGGTGAGG + Intronic
941504349 2:166322884-166322906 TTCTGATTCTAAAAATGTTGAGG + Intronic
941779534 2:169429054-169429076 TTGGGATTCTGAAAATGTTTTGG + Intergenic
942939052 2:181595278-181595300 TTGAGATTTCTCAAATGTCTTGG - Intronic
943101300 2:183490168-183490190 TTGGGATCCTTCAAATGTCTTGG + Intergenic
944201800 2:197115665-197115687 TTTAGATTTTCCAAAAGTTGAGG - Intronic
944402147 2:199340194-199340216 TTAAGTTTCTTCAAATGATGTGG + Intronic
946496190 2:220198122-220198144 TTGAGAAGATTCAAAGGTTGAGG + Intergenic
1168744173 20:222179-222201 TTGAGAATGTTCATATGGTGAGG - Intergenic
1169187042 20:3627303-3627325 TGGAGAGTTTTCAAATGTTTGGG - Intronic
1170034983 20:11980698-11980720 TTGGGAGAATTCAAATGTTGAGG + Intergenic
1170179855 20:13518144-13518166 ATGAGATTCTTAGAATGCTGAGG - Intronic
1170333519 20:15242589-15242611 TTGGTATTCTTTAAATGTTTAGG + Intronic
1170563802 20:17581762-17581784 TTGAGGTTCTTAGAATTTTGAGG + Intronic
1171230959 20:23484664-23484686 TTGAGACTATTTGAATGTTGAGG + Intergenic
1177576959 21:22970342-22970364 GTAAGATTCTTGAAATGTTTTGG - Intergenic
1184102924 22:42350810-42350832 TGGAGATTATTAAAATGTTTTGG + Intergenic
1185135653 22:49070575-49070597 CTGAGACTCTTCAAAGGCTGTGG - Intergenic
952184365 3:30952937-30952959 TTGAGATTATTCCAGTGATGTGG - Intergenic
955534865 3:59912186-59912208 TGGAGATACCTCAAATGTGGAGG - Intronic
955578833 3:60396883-60396905 TAGTGATTCTTTAAATGTTCTGG - Intronic
955769845 3:62375728-62375750 TTGATATTGTTTCAATGTTGGGG - Intergenic
956988882 3:74739232-74739254 TTGAGAATGATCAAATATTGAGG - Intergenic
957089681 3:75717389-75717411 TAGAAAATCTTCAAATTTTGAGG + Intronic
957799749 3:85060792-85060814 TTGATTTTCTTGAAATTTTGAGG - Intronic
958041875 3:88235766-88235788 TTATGATTATTCAAATTTTGAGG + Intergenic
959023915 3:101219054-101219076 TAGAAATTCTTCAAAATTTGAGG - Intergenic
959511746 3:107220732-107220754 TTGAGATTTTTCAGATGGTGTGG + Intergenic
959689188 3:109180168-109180190 AGGAGATTCTTGAAATGTAGTGG - Intergenic
959860592 3:111210830-111210852 TTGCCATTCTTCAAATATGGTGG - Intronic
961174973 3:124827722-124827744 TTGTGATTCTTCACTTGCTGCGG - Intronic
965514343 3:169604715-169604737 TTGAGTTTCTTAAGATGTTTTGG - Intronic
966431686 3:179838135-179838157 TTGAAATTCTTCAAAATTTCTGG + Intronic
970118288 4:12723901-12723923 TTGAAATAGTTCAAATATTGAGG - Intergenic
970162498 4:13203346-13203368 TGCAAATTCTGCAAATGTTGAGG - Intergenic
970516492 4:16836238-16836260 TTGAGATTCTTCAAATGTTGAGG - Intronic
972955196 4:44380877-44380899 TTGAGAGTCTTCACATTTTGTGG - Intronic
973758335 4:54096054-54096076 TTATGATTATTCAAATGTTGGGG + Intronic
974728307 4:65825861-65825883 TTGAGAGTTTTAAAATGTTCTGG - Intergenic
974747667 4:66097261-66097283 TTGAGATTAAACAAATTTTGGGG + Intergenic
974864703 4:67565857-67565879 TTGAAATTATGAAAATGTTGTGG - Intronic
975556183 4:75667478-75667500 GTGAGATTCTTCACATTTTCAGG - Intronic
975771321 4:77726041-77726063 TTTAGATTCTTAAAATGTCTAGG - Intronic
976021257 4:80629974-80629996 TTGAAATTTTTAAAATGTTTAGG + Intronic
976112331 4:81689231-81689253 TGCAGCTTCTTCAAATGCTGTGG - Intronic
976120067 4:81770367-81770389 TTGCACTTCTTCAAATGTAGAGG - Intronic
977730828 4:100349826-100349848 TTGAGATTCATCCAATTTTTTGG + Intergenic
978474634 4:109111958-109111980 GTGAGATTCTCCAAATGTATTGG - Intronic
978727519 4:111986690-111986712 TTGACATTCGTTGAATGTTGAGG - Intergenic
980071164 4:128243962-128243984 TTGACATTTTTAAAAGGTTGGGG - Intergenic
980182850 4:129423201-129423223 CTGAGATTCTTCATATATTCAGG + Intergenic
980700435 4:136421208-136421230 TTGATATTCATCATTTGTTGAGG - Intergenic
981745027 4:148044619-148044641 TTGAGATTCTCTTAATTTTGAGG + Intronic
982558101 4:156894870-156894892 TAGAGATTCTTCAAAGAATGTGG - Intronic
984305487 4:177984089-177984111 TTGATATTCTTTAAGTGATGAGG + Intronic
985218989 4:187682704-187682726 TTCAGTTTCTTAAAGTGTTGGGG - Intergenic
986377788 5:7150208-7150230 TTTGGATTTTTCAAATGTTTAGG - Intergenic
987258908 5:16183871-16183893 TTGAGATTCTTCTAAAGTGTGGG - Intergenic
987370329 5:17187230-17187252 CTGACATTTTTCAAATGGTGGGG - Intronic
987380062 5:17276409-17276431 TTGATATTTTTTTAATGTTGTGG + Exonic
989537874 5:42584447-42584469 TTTAGTTTCTTCAAAGCTTGAGG - Intronic
989686998 5:44101107-44101129 TTGAGATTCTTGAATTAGTGAGG - Intergenic
991595055 5:68295731-68295753 TTGGGATTTTTCAGATGTTCAGG - Intronic
993443644 5:87985732-87985754 TTAAAATTCTTTTAATGTTGTGG + Intergenic
993777548 5:92019192-92019214 ATGAGATTTTTCAAATGTTCTGG + Intergenic
994975149 5:106794030-106794052 TTAACATTTTTCCAATGTTGTGG - Intergenic
995803521 5:116025619-116025641 TTGAGATTTTTAAAAAATTGGGG + Intronic
996591189 5:125149532-125149554 TTGTGGTTCTTCAAATGTGGCGG - Intergenic
997212973 5:132088319-132088341 TTCAGACTCTTCCTATGTTGGGG + Intergenic
999330170 5:150668426-150668448 TTTAGTTTCTTCCTATGTTGTGG + Intronic
999496369 5:152102813-152102835 GTGTGATTCTTGAAATCTTGTGG + Intergenic
1000379192 5:160613744-160613766 TTGAGATCCTTCAAAAATTATGG - Intronic
1000419342 5:161020682-161020704 TTGTGCCTCTTCAAATTTTGTGG - Intergenic
1000551774 5:162675019-162675041 TAGCGATTGTTGAAATGTTGTGG - Intergenic
1000585009 5:163086629-163086651 TTTACATTCTTTAAATGTAGGGG + Intergenic
1001688153 5:173611140-173611162 TGGAGATTCTTAAACTTTTGAGG + Intronic
1004652536 6:17624742-17624764 TTGACTTTGTCCAAATGTTGGGG + Exonic
1005078632 6:21934249-21934271 TTGAGTTTTTTAAAATATTGTGG + Intergenic
1008755869 6:54795207-54795229 TTGATATTCTTCATATGGTTTGG + Intergenic
1010351152 6:74876014-74876036 TTGGATTTCTTCAAAAGTTGCGG - Intergenic
1010455644 6:76051228-76051250 TTGAGAATCTACTAATGTAGTGG - Intronic
1010507463 6:76677756-76677778 TTGTGGTTTTTCAAATGCTGTGG - Intergenic
1010880952 6:81170996-81171018 TTATTATTCTTCAAATGTGGAGG + Intergenic
1014383512 6:120773728-120773750 TTGTGAATCTTCAAATGCTATGG - Intergenic
1015964575 6:138685076-138685098 TTGAGTTTCTTAATATTTTGGGG - Intronic
1016075996 6:139796264-139796286 TTAAGATTCTTGAAAGGGTGAGG + Intergenic
1016514224 6:144875988-144876010 TTGAGAATCTCCTAATGTTAGGG + Intergenic
1016544434 6:145204716-145204738 TTGATATGCTTCTAATGTAGTGG - Intergenic
1017382639 6:153848068-153848090 ATGAGATTCTCCAGTTGTTGCGG + Intergenic
1017480951 6:154854208-154854230 TTGAATTTCATGAAATGTTGAGG + Intronic
1017742977 6:157423358-157423380 TTGTGATTATTCATATGGTGCGG + Intronic
1018283406 6:162212275-162212297 TTGAGAAGCTTCAAATCTCGGGG - Intronic
1018361227 6:163071251-163071273 TTGAGATGATCCACATGTTGAGG - Intronic
1019026958 6:168974922-168974944 TCCAGATTCTTTACATGTTGGGG - Intergenic
1021032680 7:15757452-15757474 TTAAGAGTCTTAAAATGTGGTGG - Intergenic
1021082035 7:16376015-16376037 TGGAAATTCTCCAAATGTGGAGG + Intronic
1021996204 7:26180232-26180254 TTGACATTCTTCAGATGAAGGGG + Intronic
1023510471 7:40947316-40947338 TTGACATTCTCCAATTGATGAGG + Intergenic
1024220948 7:47286149-47286171 TTGAGATTGTGCCAATTTTGTGG - Intronic
1028543928 7:91976854-91976876 TTGATATTCTTCATTTGGTGAGG + Intronic
1029437067 7:100569370-100569392 TTGAGTTTCTTGAAAGTTTGGGG - Intergenic
1030110523 7:106022878-106022900 TGGTGATTCTTCAAAAGATGTGG - Intronic
1030780099 7:113590051-113590073 TTTTGATTCTTTAAATGTTCAGG - Intergenic
1031000147 7:116405546-116405568 TTGTGATTCTTCCAATCTGGAGG - Intronic
1032756430 7:134895197-134895219 TTGAGATTTGTCAAAAGTTTAGG + Intronic
1032953705 7:136946413-136946435 TTTAGATTGTAAAAATGTTGAGG - Intronic
1034454913 7:151164246-151164268 TCCAAATTCTTCTAATGTTGAGG + Intronic
1035562048 8:612685-612707 CTGAGCATTTTCAAATGTTGAGG - Intergenic
1036748497 8:11427826-11427848 TTGAGTTTCTTCAATGCTTGAGG - Intronic
1037790677 8:21937847-21937869 ATGAGAATCTTCAAAGGTTTTGG + Intronic
1039047786 8:33466048-33466070 TTGAGATTCTTTAAATATAAGGG - Intronic
1039277210 8:35946437-35946459 TTCTGCTTCTTCAAATGTGGAGG + Intergenic
1040126075 8:43739524-43739546 TGGAGAATCTACAAATGTAGGGG + Intergenic
1040723345 8:50351797-50351819 AGGAGATTCTTAAAAAGTTGTGG + Intronic
1042687793 8:71461649-71461671 TTGAGACCCTCCAAATGGTGAGG - Intronic
1043064629 8:75552731-75552753 GTGAAATTCCTCAAAAGTTGGGG + Intronic
1043319871 8:78971150-78971172 ATGAGATTATTCAAATGGTAGGG + Intergenic
1043387688 8:79764839-79764861 TTAAGATTCCCCAAATTTTGAGG + Exonic
1043681095 8:83025183-83025205 ATCAGATTATTCAAAAGTTGAGG + Intergenic
1045351352 8:101343232-101343254 GTGAGATTCTTCACATGATGAGG - Intergenic
1045725220 8:105164876-105164898 TTGAGATTCTTTTCATGATGAGG + Intronic
1046297453 8:112239844-112239866 TTGAGATTCTTCTACTGTTTTGG + Intronic
1046593435 8:116232811-116232833 TTGTGATTATTGAATTGTTGAGG - Intergenic
1046994059 8:120495966-120495988 TTCAGTTGGTTCAAATGTTGGGG - Intronic
1048421637 8:134283628-134283650 TTGGGATTCACCAAATGGTGAGG - Intergenic
1048775260 8:137938879-137938901 CTGATATTTTTCAAATGTTGAGG - Intergenic
1050641663 9:7674987-7675009 CTGAGATTCTTTATATTTTGTGG + Intergenic
1052497949 9:29252012-29252034 TTTGATTTCTTCAAATGTTGGGG - Intergenic
1054877415 9:70111323-70111345 TTGCCTTTCTTCAAATGATGTGG + Intronic
1060712124 9:125877672-125877694 TTCAGATTCTGAAAATGTTATGG - Intronic
1203487885 Un_GL000224v1:74337-74359 TAGAAAATCTTCAAATTTTGAGG - Intergenic
1203500506 Un_KI270741v1:16232-16254 TAGAAAATCTTCAAATTTTGAGG - Intergenic
1186155498 X:6721520-6721542 TTGGTAATCTCCAAATGTTGTGG + Intergenic
1188061681 X:25608594-25608616 TTGAGAGTTATCAAATATTGAGG + Intergenic
1189709215 X:43792020-43792042 TTGAGATTCTGAAAATGTCTTGG - Intronic
1192368868 X:70497345-70497367 TTGAGATCCTAGAAATGCTGTGG + Intronic
1192454567 X:71266228-71266250 TGGAGCTTTTTCTAATGTTGGGG - Intergenic
1193130270 X:77912203-77912225 GTGAGATTTTTTAAATGTTTAGG - Intronic
1193416535 X:81230950-81230972 ATGAGATTTTTCATATCTTGTGG + Intronic
1194678986 X:96828507-96828529 TTGTGATTCTTCAAAGGGAGGGG - Intronic
1195288006 X:103404221-103404243 TAGAGAGTCTAGAAATGTTGTGG + Intergenic
1198123518 X:133619702-133619724 TTGAGATGATTCAAATATTCTGG + Intronic
1198610745 X:138396957-138396979 TTTGGACTCTACAAATGTTGTGG + Intergenic
1198818541 X:140619414-140619436 CTGAGATTCTGCTAATGTTTTGG + Intergenic
1199138261 X:144279043-144279065 TAGTGATTCTAGAAATGTTGAGG + Intergenic
1199358512 X:146888917-146888939 TTGATATTATTAAAATTTTGTGG - Intergenic
1200303592 X:155003074-155003096 TTCAGTCTCTTCAAATTTTGTGG - Intronic
1201392215 Y:13511068-13511090 TTGAGAGATTTCAAATGTTATGG + Intergenic
1201947306 Y:19525840-19525862 TTGAGATTCTGCATCTGATGAGG + Intergenic