ID: 970519659

View in Genome Browser
Species Human (GRCh38)
Location 4:16869813-16869835
Sequence CCTCAAATACTTAAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970519659_970519662 -4 Left 970519659 4:16869813-16869835 CCTTCCATCTTAAGTATTTGAGG 0: 1
1: 0
2: 1
3: 13
4: 139
Right 970519662 4:16869832-16869854 GAGGAACATCCTGCTGTTTTAGG 0: 1
1: 0
2: 3
3: 11
4: 156
970519659_970519664 8 Left 970519659 4:16869813-16869835 CCTTCCATCTTAAGTATTTGAGG 0: 1
1: 0
2: 1
3: 13
4: 139
Right 970519664 4:16869844-16869866 GCTGTTTTAGGTTGCAAATTTGG 0: 1
1: 0
2: 0
3: 16
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970519659 Original CRISPR CCTCAAATACTTAAGATGGA AGG (reversed) Intronic
901438374 1:9263147-9263169 CCTCAAATACCTAAGAGTCAGGG + Intronic
904705906 1:32390612-32390634 CCTCAAACACTAAAGCTGGCCGG + Intronic
905057032 1:35104698-35104720 TCCCACATACTTCAGATGGAAGG + Exonic
906592859 1:47044383-47044405 CATCAAAGACATAAAATGGAGGG - Intronic
908641759 1:66231628-66231650 CCTCAAATACTTAAATTTGAAGG + Intronic
916629636 1:166598165-166598187 CCTCAAATATTTGAGATAGTAGG + Intergenic
917127610 1:171702223-171702245 CCTGAAATCCTTAAAATGGCTGG - Exonic
919253574 1:195093195-195093217 CCTCAATTAATTAAAATGAAAGG - Intergenic
919331788 1:196181533-196181555 CCTCTAATTCTTCAGATGGAAGG - Intergenic
919376496 1:196800902-196800924 CCTCAAATACTGGGGATAGAAGG - Intergenic
919386193 1:196925815-196925837 CCTCAAATACTGGGGATGGAAGG - Intronic
922035153 1:221840535-221840557 CCACAAATACTTAAGATACACGG - Intergenic
1064344901 10:14523060-14523082 TCTCGAATATTTCAGATGGAGGG - Intronic
1070809192 10:79289118-79289140 CCTCAAACACCTAAGATGCCTGG - Intronic
1070881464 10:79854778-79854800 CCTTAAATACTTCATATGAAGGG + Intergenic
1071648038 10:87371092-87371114 CCTTAAATACTTCATATGAAGGG + Intergenic
1072790455 10:98313959-98313981 TTTCAAAGACTTAAGAAGGAAGG + Intergenic
1073601470 10:104850127-104850149 TCCCAAATAATTAACATGGAAGG + Intronic
1074708914 10:116160847-116160869 CCTCAACTACTTAGAAAGGAGGG + Intronic
1078204841 11:9219695-9219717 CCTCAAATAATCCAGATTGATGG + Intronic
1081010779 11:37810198-37810220 CCCCAAATACTTAAGATAAATGG - Intergenic
1081373960 11:42337813-42337835 TCTCAAATAATTAAGATAAATGG - Intergenic
1081465935 11:43317345-43317367 CCTCAAATACTCATAATGGGAGG - Intronic
1086865893 11:91979984-91980006 TCTGAATTTCTTAAGATGGATGG - Intergenic
1090707492 11:129352228-129352250 ACTCAATTATTTAAGAAGGAGGG + Intergenic
1094088732 12:26623940-26623962 CCTCAAATATCTAAGATTCAGGG + Intronic
1094304268 12:29000229-29000251 CATCAAATGCTTAATATGCAGGG - Intergenic
1098659706 12:73076403-73076425 ACTCAAATACTACAGCTGGAAGG - Intergenic
1103457561 12:121078064-121078086 CATAAAATACTTTAGATGGATGG + Intergenic
1106697867 13:32197439-32197461 CCTGAAATACTCCAGATGGATGG - Intronic
1107101455 13:36597825-36597847 CCTCTACTTCTTCAGATGGAAGG + Intergenic
1107925674 13:45259491-45259513 GCTTAAAAACTTAAGATGGCTGG - Intronic
1109916594 13:68995249-68995271 CTTCAAATTCTTAAGATGGAAGG - Intergenic
1110338574 13:74362488-74362510 CCTCAAATACTTAATTCTGAAGG + Intergenic
1113138300 13:107117938-107117960 CCTCAAATCCAGAAGACGGATGG - Intergenic
1118495679 14:66306120-66306142 CCTCAAATGTCTAAGTTGGAGGG - Intergenic
1120176454 14:81298398-81298420 CCTCAACTGCTTCAGATGGGGGG + Intronic
1121082664 14:91120856-91120878 TCTCAAATACTTACGACAGAGGG + Intronic
1121601321 14:95205877-95205899 CCCCAAAAAGTTAAGAAGGAAGG + Intronic
1121645008 14:95511986-95512008 CCTGAAATATTTGAGCTGGAAGG - Intergenic
1125051503 15:35303223-35303245 GTTCAAATATTAAAGATGGAAGG - Intronic
1126249772 15:46553762-46553784 CCTCAAATCCTTAGGCTGGCCGG - Intergenic
1127460637 15:59195322-59195344 CCTGAAAAAGTTAAGATGCAAGG + Intronic
1130625062 15:85505968-85505990 TCTTAAATACTTAAGATGACTGG - Intronic
1132315913 15:100890219-100890241 CCTCAGATACTAAAGAATGACGG - Intronic
1134019534 16:10911878-10911900 CCTGAGATAATTGAGATGGAAGG - Intronic
1134218383 16:12334125-12334147 CCTCAAAGACCTAAAGTGGATGG - Intronic
1143228710 17:5332455-5332477 TCTCAAATAATTAAGCTGTATGG + Intronic
1149813146 17:59697393-59697415 CTTCAAACACTTGTGATGGAGGG + Exonic
1150186951 17:63191960-63191982 AATCTAAGACTTAAGATGGAGGG + Intronic
1153454499 18:5265271-5265293 GCCCAAAAACTTAAGAAGGATGG + Intergenic
1155656565 18:28200235-28200257 TCTCAAAAACTTAACATTGATGG - Intergenic
1156899584 18:42285429-42285451 CCTCAAATACTTAAACAGAAAGG - Intergenic
1159299469 18:66544050-66544072 CTTCAAATACATAATATGGAAGG + Exonic
1168208448 19:54870377-54870399 TCTCAAACACCTAAGAAGGAAGG - Intergenic
930466743 2:51762407-51762429 TCTCAAATACTTAGAAGGGAAGG + Intergenic
930921834 2:56765208-56765230 CTACAAATAATTAAGATGAAAGG - Intergenic
931980626 2:67690110-67690132 CCTCTAATAATTCAGATAGAAGG + Intergenic
933058274 2:77701600-77701622 CCTCAAATACTTGAAAAGAAGGG - Intergenic
933604555 2:84368624-84368646 CCTCAAAAACTTCTAATGGAGGG - Intergenic
935718903 2:105962131-105962153 CCTGAAATAATAAAAATGGAAGG + Intergenic
936446870 2:112602941-112602963 CATCAAAGACTAAAGATGCAGGG + Intergenic
938209094 2:129450453-129450475 CCTCAAATACTAAGAATAGAAGG + Intergenic
939437604 2:142199016-142199038 CCTCAAAGACAAAATATGGAGGG - Intergenic
940387719 2:153093021-153093043 CCTCAAAAACTGAGGATAGAAGG - Intergenic
940757746 2:157703015-157703037 TCCCAAAAACTTAAGAAGGAGGG + Intergenic
941680569 2:168394127-168394149 CCACAAACACTTATGACGGAGGG - Intergenic
942683431 2:178505321-178505343 CATCTTAAACTTAAGATGGAAGG - Exonic
1170945154 20:20884897-20884919 CATCCAATGCTTAAGAGGGAAGG + Intergenic
1172224791 20:33298197-33298219 CCTCAAACCCTTTGGATGGAGGG - Intronic
1172225221 20:33300967-33300989 CCTCAAACCCTTTGGATGGAGGG - Intronic
1178158305 21:29880863-29880885 CTTAAAACACTTAAGCTGGAAGG + Intronic
1180674713 22:17579381-17579403 AATAAAATACTTAAGATGGCCGG - Intronic
1182225484 22:28794871-28794893 CCTAAAATACTTATTATGTAAGG - Exonic
1182614021 22:31573864-31573886 CGACAAATACTTAAGATGTAGGG - Intronic
1182731678 22:32500939-32500961 TCTCAAAATCTTAAGTTGGAAGG - Intergenic
1184998818 22:48229213-48229235 CCTCAAATCCTTCAGAGGGAGGG + Intergenic
950807115 3:15614989-15615011 CCCCAACAACTTCAGATGGAAGG - Intronic
952589687 3:34935849-34935871 GCCAAAATACTTAAAATGGATGG + Intergenic
955964474 3:64374244-64374266 CCACCAAGACTTATGATGGAAGG + Intronic
959241538 3:103801947-103801969 CCTAAAAAACTTGAGATGTAAGG - Intergenic
964414119 3:156429635-156429657 CATTAAATATTTAACATGGATGG + Intronic
965472240 3:169109150-169109172 CCACAAATAGGTAAGATGCAGGG - Intronic
965526674 3:169727321-169727343 CCTCAAAAACTGAGGATAGAAGG - Intergenic
966759984 3:183409194-183409216 CATAAAATACTTAAGATTCAGGG + Intronic
970012939 4:11480571-11480593 ACTAAAATGCTTAAGATTGAAGG + Intergenic
970519659 4:16869813-16869835 CCTCAAATACTTAAGATGGAAGG - Intronic
971443515 4:26716733-26716755 CCTCAAATTATTAAGACTGATGG + Intronic
974499116 4:62675322-62675344 CTTCAAAAACTTAAGGAGGATGG - Intergenic
979212511 4:118122307-118122329 TTTCATTTACTTAAGATGGAGGG + Intronic
979351498 4:119649021-119649043 CATAAAATACTTAAGAGGAATGG + Intergenic
979980635 4:127250341-127250363 CCTTAAAAACTTAAAATTGAAGG + Intergenic
983643402 4:169965134-169965156 TCTGACATACTGAAGATGGATGG + Intergenic
984120773 4:175739678-175739700 CCTCAAATTCTTAAGGTTCAGGG + Intronic
984338849 4:178427696-178427718 CCTCAAAAACTTAGGAGAGAAGG + Intergenic
986639204 5:9855323-9855345 CCTCTAGTTCTTTAGATGGAAGG + Intergenic
986896815 5:12381248-12381270 CTTCAAAAAATTAAGAAGGAGGG - Intergenic
987612155 5:20219798-20219820 CCTCAAAAACTGAATATAGAAGG + Intronic
988607838 5:32695566-32695588 CCTCAAAAACTAAAAATAGAGGG - Intronic
988773706 5:34456360-34456382 CCTCAAATACCTAAGCTAAAGGG - Intergenic
989959903 5:50400359-50400381 CCTCAGATTCTAAAGATTGACGG + Intronic
990077072 5:51860404-51860426 CCTCTAAAACAAAAGATGGAAGG - Intergenic
991146867 5:63317357-63317379 CCACAAATATATAAGCTGGAAGG - Intergenic
992423001 5:76625764-76625786 CATTTAAAACTTAAGATGGATGG - Intronic
993184713 5:84602311-84602333 CCTCAACTAATGAAGTTGGACGG + Intergenic
993235386 5:85301313-85301335 CCTAAGATACTTAATATGGTTGG + Intergenic
993503417 5:88685679-88685701 TCTCAAATACTGAATATGGTCGG - Intergenic
996631066 5:125633150-125633172 CCTCATAAATCTAAGATGGAAGG - Intergenic
997259553 5:132455590-132455612 CCACAAATACATAGGATGAAAGG - Intronic
998353157 5:141514032-141514054 CCCCAGATTCTTAAGTTGGAAGG - Intergenic
1008205200 6:48647428-48647450 TCCCAAAAACTTAAGAAGGAAGG + Intergenic
1009436126 6:63620337-63620359 CCTCAGAGACTTTAGATGTAGGG + Intergenic
1010138482 6:72583869-72583891 ACTCTAATACTTAAGATTCAAGG + Intergenic
1011958262 6:93052392-93052414 CCTCAAATTCTAATGATTGATGG - Intergenic
1014505127 6:122246399-122246421 CTTCAAAAAATTAAAATGGATGG + Intergenic
1016272746 6:142307758-142307780 TCTCAAATATTTTGGATGGATGG + Intronic
1025027942 7:55533615-55533637 CCTCAGCTTCTTCAGATGGAAGG + Intronic
1025274351 7:57563405-57563427 CCTGAAATACCTAAGACTGAGGG + Intergenic
1027231364 7:76274554-76274576 GCTCAAATTCAGAAGATGGAAGG - Intronic
1027349151 7:77292889-77292911 CCACAAAGACTTAAAATGGCAGG - Intronic
1027678550 7:81189543-81189565 CCTCAAAGAATTAACAGGGATGG + Intronic
1028983340 7:96991311-96991333 CCTGAAATACATAACATGGGAGG + Intergenic
1030513466 7:110514131-110514153 CCCCAAAAACTTGAGAAGGAGGG - Intergenic
1030777176 7:113548580-113548602 CATCAAATACTTAAGAAGAGAGG + Intergenic
1031871985 7:127097464-127097486 CCACATATAGTTAAGATTGAAGG + Intronic
1032999893 7:137492582-137492604 CCACAGAAACTTAAGCTGGAAGG + Intronic
1033785051 7:144719889-144719911 CCTCCAAGACTGAAGCTGGAGGG - Intronic
1034062839 7:148108845-148108867 CCTCAAATACTTAACATTTTGGG - Intronic
1036063112 8:5347640-5347662 GCTCAATTACCTAAGATGCATGG - Intergenic
1036390935 8:8323940-8323962 CCATAAATAATGAAGATGGACGG + Intronic
1038475366 8:27862559-27862581 CCTCAAATGATTAGGTTGGATGG - Intergenic
1038943353 8:32330220-32330242 CCACCAATATTTTAGATGGATGG + Intronic
1042242888 8:66682103-66682125 CCTAAAATGCTTTAGAAGGAAGG - Intronic
1042290948 8:67168941-67168963 CCTCTAATACTTAAGGTGAAAGG - Intronic
1043832025 8:85001183-85001205 CCACAAATAGTTTAGCTGGATGG + Intergenic
1045637557 8:104209677-104209699 CCTGAAGTACTTAAGATAGTAGG + Intronic
1046586279 8:116152096-116152118 TCCCAAATACTGAAGATGTATGG + Intergenic
1048217682 8:132511431-132511453 CCTCCAATACTTTATCTGGAAGG + Intergenic
1049140305 8:140948716-140948738 CCTCAAATATTTTAGATCCATGG - Intronic
1049940859 9:544941-544963 CCTCACATACCCAAGCTGGAGGG - Intronic
1050982224 9:12035131-12035153 CCTTGAAGACTTAAGATGGGGGG + Intergenic
1051858412 9:21596504-21596526 CCTAAAATTCTTAAATTGGAGGG + Intergenic
1053299191 9:36936576-36936598 CCTCAAATACCTAGCATGGGAGG + Intronic
1055602084 9:77930332-77930354 CCTTAAATAATTAAAATGAAAGG - Intronic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1061817000 9:133203584-133203606 CCTCAAATATTTCAGATGTTGGG + Intergenic
1185717557 X:2354765-2354787 CTTCAGCTGCTTAAGATGGACGG - Intronic
1185966925 X:4616068-4616090 CCCCAAATAGTGAACATGGATGG - Intergenic
1186373633 X:8973012-8973034 CCTGAAATACTTCATATGGTAGG - Intergenic
1187901189 X:24028108-24028130 TCTCAAATACTTAGGCTAGAGGG - Intergenic
1197152347 X:123233824-123233846 CCTCAAATACTTACTATTCATGG - Intronic
1197435290 X:126420584-126420606 CTTCAAAAACTGAAGATAGAAGG - Intergenic
1197610446 X:128632474-128632496 CCTCAAGTGCTTTAGATGGAAGG - Intergenic
1198506447 X:137306064-137306086 CATCAGATACTTAACATGGAGGG - Intergenic