ID: 970525451

View in Genome Browser
Species Human (GRCh38)
Location 4:16927520-16927542
Sequence GGTGCTGAACACTGCACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970525448_970525451 21 Left 970525448 4:16927476-16927498 CCTCGAGATGAGAGGGCAATTCT No data
Right 970525451 4:16927520-16927542 GGTGCTGAACACTGCACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970525451 Original CRISPR GGTGCTGAACACTGCACTCC AGG Intergenic
No off target data available for this crispr