ID: 970530021

View in Genome Browser
Species Human (GRCh38)
Location 4:16971979-16972001
Sequence CTTCATAGTTGGCGATAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970530014_970530021 26 Left 970530014 4:16971930-16971952 CCGAGTGCCTAGTAGACAGGGTT No data
Right 970530021 4:16971979-16972001 CTTCATAGTTGGCGATAAATGGG No data
970530018_970530021 1 Left 970530018 4:16971955-16971977 CCTAAAAAGGACAATTAGAAAAG No data
Right 970530021 4:16971979-16972001 CTTCATAGTTGGCGATAAATGGG No data
970530015_970530021 19 Left 970530015 4:16971937-16971959 CCTAGTAGACAGGGTTTCCCTAA No data
Right 970530021 4:16971979-16972001 CTTCATAGTTGGCGATAAATGGG No data
970530017_970530021 2 Left 970530017 4:16971954-16971976 CCCTAAAAAGGACAATTAGAAAA No data
Right 970530021 4:16971979-16972001 CTTCATAGTTGGCGATAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970530021 Original CRISPR CTTCATAGTTGGCGATAAAT GGG Intergenic
No off target data available for this crispr