ID: 970531081

View in Genome Browser
Species Human (GRCh38)
Location 4:16984991-16985013
Sequence TTCTATTTAAAAATCCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970531081_970531084 24 Left 970531081 4:16984991-16985013 CCCACCAGGATTTTTAAATAGAA No data
Right 970531084 4:16985038-16985060 TTATGAAAATGTAAAGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970531081 Original CRISPR TTCTATTTAAAAATCCTGGT GGG (reversed) Intergenic
No off target data available for this crispr