ID: 970531084

View in Genome Browser
Species Human (GRCh38)
Location 4:16985038-16985060
Sequence TTATGAAAATGTAAAGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970531083_970531084 20 Left 970531083 4:16984995-16985017 CCAGGATTTTTAAATAGAAATTT No data
Right 970531084 4:16985038-16985060 TTATGAAAATGTAAAGAACCTGG No data
970531081_970531084 24 Left 970531081 4:16984991-16985013 CCCACCAGGATTTTTAAATAGAA No data
Right 970531084 4:16985038-16985060 TTATGAAAATGTAAAGAACCTGG No data
970531082_970531084 23 Left 970531082 4:16984992-16985014 CCACCAGGATTTTTAAATAGAAA No data
Right 970531084 4:16985038-16985060 TTATGAAAATGTAAAGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970531084 Original CRISPR TTATGAAAATGTAAAGAACC TGG Intergenic
No off target data available for this crispr