ID: 970536638

View in Genome Browser
Species Human (GRCh38)
Location 4:17036654-17036676
Sequence TAAAAATTAGCCGAGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 357521
Summary {0: 68, 1: 2304, 2: 26366, 3: 119501, 4: 209282}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970536638_970536641 15 Left 970536638 4:17036654-17036676 CCACCACACTCGGCTAATTTTTA 0: 68
1: 2304
2: 26366
3: 119501
4: 209282
Right 970536641 4:17036692-17036714 TGAGGACCCACTATGTGCTCAGG No data
970536638_970536645 24 Left 970536638 4:17036654-17036676 CCACCACACTCGGCTAATTTTTA 0: 68
1: 2304
2: 26366
3: 119501
4: 209282
Right 970536645 4:17036701-17036723 ACTATGTGCTCAGGCTGGTCTGG No data
970536638_970536642 19 Left 970536638 4:17036654-17036676 CCACCACACTCGGCTAATTTTTA 0: 68
1: 2304
2: 26366
3: 119501
4: 209282
Right 970536642 4:17036696-17036718 GACCCACTATGTGCTCAGGCTGG No data
970536638_970536640 -3 Left 970536638 4:17036654-17036676 CCACCACACTCGGCTAATTTTTA 0: 68
1: 2304
2: 26366
3: 119501
4: 209282
Right 970536640 4:17036674-17036696 TTAAAAATTTTGTAGAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970536638 Original CRISPR TAAAAATTAGCCGAGTGTGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr