ID: 970536639

View in Genome Browser
Species Human (GRCh38)
Location 4:17036657-17036679
Sequence TTTTAAAAATTAGCCGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40993
Summary {0: 11, 1: 188, 2: 1382, 3: 6214, 4: 33198}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970536639_970536640 -6 Left 970536639 4:17036657-17036679 CCACACTCGGCTAATTTTTAAAA 0: 11
1: 188
2: 1382
3: 6214
4: 33198
Right 970536640 4:17036674-17036696 TTAAAAATTTTGTAGAAATGAGG No data
970536639_970536641 12 Left 970536639 4:17036657-17036679 CCACACTCGGCTAATTTTTAAAA 0: 11
1: 188
2: 1382
3: 6214
4: 33198
Right 970536641 4:17036692-17036714 TGAGGACCCACTATGTGCTCAGG No data
970536639_970536646 30 Left 970536639 4:17036657-17036679 CCACACTCGGCTAATTTTTAAAA 0: 11
1: 188
2: 1382
3: 6214
4: 33198
Right 970536646 4:17036710-17036732 TCAGGCTGGTCTGGAACTCTTGG No data
970536639_970536642 16 Left 970536639 4:17036657-17036679 CCACACTCGGCTAATTTTTAAAA 0: 11
1: 188
2: 1382
3: 6214
4: 33198
Right 970536642 4:17036696-17036718 GACCCACTATGTGCTCAGGCTGG No data
970536639_970536645 21 Left 970536639 4:17036657-17036679 CCACACTCGGCTAATTTTTAAAA 0: 11
1: 188
2: 1382
3: 6214
4: 33198
Right 970536645 4:17036701-17036723 ACTATGTGCTCAGGCTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970536639 Original CRISPR TTTTAAAAATTAGCCGAGTG TGG (reversed) Intergenic
Too many off-targets to display for this crispr