ID: 970536642

View in Genome Browser
Species Human (GRCh38)
Location 4:17036696-17036718
Sequence GACCCACTATGTGCTCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970536639_970536642 16 Left 970536639 4:17036657-17036679 CCACACTCGGCTAATTTTTAAAA 0: 11
1: 188
2: 1382
3: 6214
4: 33198
Right 970536642 4:17036696-17036718 GACCCACTATGTGCTCAGGCTGG No data
970536638_970536642 19 Left 970536638 4:17036654-17036676 CCACCACACTCGGCTAATTTTTA 0: 68
1: 2304
2: 26366
3: 119501
4: 209282
Right 970536642 4:17036696-17036718 GACCCACTATGTGCTCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970536642 Original CRISPR GACCCACTATGTGCTCAGGC TGG Intergenic
No off target data available for this crispr