ID: 970546745

View in Genome Browser
Species Human (GRCh38)
Location 4:17137713-17137735
Sequence TGGGTCAGTAGGGGATGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970546745_970546752 -1 Left 970546745 4:17137713-17137735 CCAGGCCATCCCCTACTGACCCA No data
Right 970546752 4:17137735-17137757 AGACCCCCAAGCCAACCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970546745 Original CRISPR TGGGTCAGTAGGGGATGGCC TGG (reversed) Intergenic