ID: 970548015

View in Genome Browser
Species Human (GRCh38)
Location 4:17149208-17149230
Sequence CTGTATCAGTAGAGTGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970548014_970548015 -6 Left 970548014 4:17149191-17149213 CCTAGTCTCAGGTATGTCTGTAT 0: 20
1: 2868
2: 6273
3: 10635
4: 11288
Right 970548015 4:17149208-17149230 CTGTATCAGTAGAGTGAAAATGG No data
970548012_970548015 6 Left 970548012 4:17149179-17149201 CCTCTTTTTCTTCCTAGTCTCAG 0: 16
1: 434
2: 654
3: 929
4: 1133
Right 970548015 4:17149208-17149230 CTGTATCAGTAGAGTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970548015 Original CRISPR CTGTATCAGTAGAGTGAAAA TGG Intergenic
No off target data available for this crispr