ID: 970548575

View in Genome Browser
Species Human (GRCh38)
Location 4:17155603-17155625
Sequence CAGGATTCAGAGGATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970548569_970548575 -6 Left 970548569 4:17155586-17155608 CCTCCACATGGCCCCTACAGGAT No data
Right 970548575 4:17155603-17155625 CAGGATTCAGAGGATGCTGCTGG No data
970548570_970548575 -9 Left 970548570 4:17155589-17155611 CCACATGGCCCCTACAGGATTCA No data
Right 970548575 4:17155603-17155625 CAGGATTCAGAGGATGCTGCTGG No data
970548567_970548575 -3 Left 970548567 4:17155583-17155605 CCTCCTCCACATGGCCCCTACAG No data
Right 970548575 4:17155603-17155625 CAGGATTCAGAGGATGCTGCTGG No data
970548565_970548575 2 Left 970548565 4:17155578-17155600 CCCAGCCTCCTCCACATGGCCCC No data
Right 970548575 4:17155603-17155625 CAGGATTCAGAGGATGCTGCTGG No data
970548566_970548575 1 Left 970548566 4:17155579-17155601 CCAGCCTCCTCCACATGGCCCCT No data
Right 970548575 4:17155603-17155625 CAGGATTCAGAGGATGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970548575 Original CRISPR CAGGATTCAGAGGATGCTGC TGG Intergenic
No off target data available for this crispr