ID: 970550592

View in Genome Browser
Species Human (GRCh38)
Location 4:17177188-17177210
Sequence CAAACTGAGCAGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970550587_970550592 5 Left 970550587 4:17177160-17177182 CCCTGAATTATCAGAATGTCTCA No data
Right 970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG No data
970550588_970550592 4 Left 970550588 4:17177161-17177183 CCTGAATTATCAGAATGTCTCAT No data
Right 970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970550592 Original CRISPR CAAACTGAGCAGAGGGAGGC AGG Intergenic
No off target data available for this crispr