ID: 970565012

View in Genome Browser
Species Human (GRCh38)
Location 4:17323468-17323490
Sequence CATTTTGCTGTGATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970565012_970565020 11 Left 970565012 4:17323468-17323490 CCCTGCTCCATCACAGCAAAATG No data
Right 970565020 4:17323502-17323524 GCAAGGAAGGGCACCTGTGTGGG No data
970565012_970565018 -1 Left 970565012 4:17323468-17323490 CCCTGCTCCATCACAGCAAAATG No data
Right 970565018 4:17323490-17323512 GACGAAAGGAAAGCAAGGAAGGG No data
970565012_970565017 -2 Left 970565012 4:17323468-17323490 CCCTGCTCCATCACAGCAAAATG No data
Right 970565017 4:17323489-17323511 TGACGAAAGGAAAGCAAGGAAGG No data
970565012_970565019 10 Left 970565012 4:17323468-17323490 CCCTGCTCCATCACAGCAAAATG No data
Right 970565019 4:17323501-17323523 AGCAAGGAAGGGCACCTGTGTGG No data
970565012_970565016 -6 Left 970565012 4:17323468-17323490 CCCTGCTCCATCACAGCAAAATG No data
Right 970565016 4:17323485-17323507 AAAATGACGAAAGGAAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970565012 Original CRISPR CATTTTGCTGTGATGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr