ID: 970569424

View in Genome Browser
Species Human (GRCh38)
Location 4:17365189-17365211
Sequence ACTGGTTGTGTTCACCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970569424_970569430 26 Left 970569424 4:17365189-17365211 CCTGCATGGTGAACACAACCAGT No data
Right 970569430 4:17365238-17365260 CCTGGAGAATGAACTCCAAATGG No data
970569424_970569428 8 Left 970569424 4:17365189-17365211 CCTGCATGGTGAACACAACCAGT No data
Right 970569428 4:17365220-17365242 ACTTTGGAAACAAGAAAACCTGG No data
970569424_970569425 -8 Left 970569424 4:17365189-17365211 CCTGCATGGTGAACACAACCAGT No data
Right 970569425 4:17365204-17365226 CAACCAGTCCACACTAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970569424 Original CRISPR ACTGGTTGTGTTCACCATGC AGG (reversed) Intergenic
No off target data available for this crispr