ID: 970576884

View in Genome Browser
Species Human (GRCh38)
Location 4:17436828-17436850
Sequence CGGGGTCCACTCTGAGTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970576866_970576884 26 Left 970576866 4:17436779-17436801 CCGGCGCACCCTCCGCAGCTGCT 0: 67
1: 187
2: 299
3: 429
4: 654
Right 970576884 4:17436828-17436850 CGGGGTCCACTCTGAGTGCGGGG No data
970576873_970576884 1 Left 970576873 4:17436804-17436826 CCCGGGTGCTAAGCCCCTCACTG 0: 284
1: 898
2: 670
3: 309
4: 255
Right 970576884 4:17436828-17436850 CGGGGTCCACTCTGAGTGCGGGG No data
970576865_970576884 27 Left 970576865 4:17436778-17436800 CCCGGCGCACCCTCCGCAGCTGC 0: 67
1: 199
2: 245
3: 310
4: 729
Right 970576884 4:17436828-17436850 CGGGGTCCACTCTGAGTGCGGGG No data
970576874_970576884 0 Left 970576874 4:17436805-17436827 CCGGGTGCTAAGCCCCTCACTGC 0: 554
1: 662
2: 423
3: 218
4: 228
Right 970576884 4:17436828-17436850 CGGGGTCCACTCTGAGTGCGGGG No data
970576871_970576884 17 Left 970576871 4:17436788-17436810 CCTCCGCAGCTGCTGGCCCGGGT 0: 134
1: 484
2: 644
3: 407
4: 340
Right 970576884 4:17436828-17436850 CGGGGTCCACTCTGAGTGCGGGG No data
970576869_970576884 18 Left 970576869 4:17436787-17436809 CCCTCCGCAGCTGCTGGCCCGGG 0: 137
1: 474
2: 642
3: 391
4: 357
Right 970576884 4:17436828-17436850 CGGGGTCCACTCTGAGTGCGGGG No data
970576872_970576884 14 Left 970576872 4:17436791-17436813 CCGCAGCTGCTGGCCCGGGTGCT 0: 191
1: 507
2: 467
3: 251
4: 382
Right 970576884 4:17436828-17436850 CGGGGTCCACTCTGAGTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970576884 Original CRISPR CGGGGTCCACTCTGAGTGCG GGG Intergenic
No off target data available for this crispr