ID: 970581305

View in Genome Browser
Species Human (GRCh38)
Location 4:17476663-17476685
Sequence GTAAAATAAAGGCCACTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 174}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970581305_970581313 17 Left 970581305 4:17476663-17476685 CCCCCCAGTGGCCTTTATTTTAC 0: 1
1: 0
2: 0
3: 22
4: 174
Right 970581313 4:17476703-17476725 ACAATAGAAATTGACCTGAAGGG 0: 1
1: 0
2: 0
3: 15
4: 238
970581305_970581314 18 Left 970581305 4:17476663-17476685 CCCCCCAGTGGCCTTTATTTTAC 0: 1
1: 0
2: 0
3: 22
4: 174
Right 970581314 4:17476704-17476726 CAATAGAAATTGACCTGAAGGGG 0: 1
1: 0
2: 1
3: 12
4: 199
970581305_970581312 16 Left 970581305 4:17476663-17476685 CCCCCCAGTGGCCTTTATTTTAC 0: 1
1: 0
2: 0
3: 22
4: 174
Right 970581312 4:17476702-17476724 TACAATAGAAATTGACCTGAAGG No data
970581305_970581311 -10 Left 970581305 4:17476663-17476685 CCCCCCAGTGGCCTTTATTTTAC 0: 1
1: 0
2: 0
3: 22
4: 174
Right 970581311 4:17476676-17476698 TTTATTTTACATCTAAGTGATGG 0: 1
1: 0
2: 4
3: 47
4: 413
970581305_970581315 29 Left 970581305 4:17476663-17476685 CCCCCCAGTGGCCTTTATTTTAC 0: 1
1: 0
2: 0
3: 22
4: 174
Right 970581315 4:17476715-17476737 GACCTGAAGGGGAAAAAACTTGG 0: 1
1: 0
2: 0
3: 18
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970581305 Original CRISPR GTAAAATAAAGGCCACTGGG GGG (reversed) Intronic
900676384 1:3889397-3889419 GTATAAGAAAGGACACTGGCCGG + Exonic
902581952 1:17413420-17413442 AAAAAATAAAGAACACTGGGAGG + Intronic
902771076 1:18646026-18646048 GAAAAATAAAGTCCAATGTGGGG + Intronic
904215862 1:28918346-28918368 GAAAAATACAGGCCATTGGCTGG - Intronic
904577543 1:31514707-31514729 GAAGAATGAAGACCACTGGGGGG - Intergenic
905937581 1:41837089-41837111 ACAAAATGAAGGCCATTGGGCGG - Intronic
906568143 1:46814976-46814998 GTCAAATGAAGGTCTCTGGGAGG - Intronic
907006436 1:50919455-50919477 ATAAAATAAAGGCTGCCGGGGGG + Intronic
908848184 1:68346385-68346407 GAAAAATAAATTCCACTAGGGGG - Intergenic
908911665 1:69078767-69078789 GTTAAAGCAAGGCCACTGGGGGG + Intergenic
909496663 1:76286510-76286532 GAAAAATAAAGGCCAGGAGGAGG - Intronic
909605391 1:77502748-77502770 GTAAACTGTAGGCCTCTGGGAGG - Intronic
910409587 1:86926150-86926172 GTAATACACAGGGCACTGGGTGG - Intronic
912987454 1:114448738-114448760 TTAAAATAAAAGTCACTGTGTGG + Intronic
913069206 1:115284326-115284348 GTGAGATAAAGGCCTCAGGGAGG - Intergenic
917494710 1:175529763-175529785 GGAAAAGAAAGGTCAGTGGGTGG - Intronic
918059812 1:181051346-181051368 GTAAAATAAATGCTACTAGGAGG - Intronic
918981647 1:191568300-191568322 GTAAAATAAAGAACAGTGGGAGG + Intergenic
921475964 1:215610043-215610065 GTAAGATAAAGGGGACAGGGAGG + Intronic
921714087 1:218400826-218400848 GGAAAACAGTGGCCACTGGGCGG + Intronic
921722071 1:218483513-218483535 GGATAATAAAAACCACTGGGAGG - Intergenic
923660334 1:235951780-235951802 GTCAATTCAAGGCCTCTGGGTGG + Intergenic
923806811 1:237266557-237266579 GTTAATTAAAGGCAACTGGAAGG + Intronic
924705364 1:246497043-246497065 AAAAAATAAAGGCCACTTGTGGG - Intronic
1064334067 10:14422735-14422757 GTAAAATAAAGTCCTGAGGGTGG - Intronic
1065976057 10:30843224-30843246 GGGAAATAAAGGCCACAGGTGGG + Intronic
1067532961 10:47087874-47087896 CTAAGATAAAGACCAGTGGGTGG + Intergenic
1067656964 10:48201029-48201051 CTAAAATAAATAACACTGGGAGG - Intronic
1068074823 10:52239573-52239595 GTAAAATGAAAGAAACTGGGAGG - Intronic
1070727272 10:78801057-78801079 ATAAAATATGGGCCCCTGGGCGG + Intergenic
1071047209 10:81395873-81395895 GTAAATTAAAGGCAAATGGATGG - Intergenic
1071575046 10:86718944-86718966 CAGAAATAAAGGCCTCTGGGTGG - Intronic
1073420467 10:103420150-103420172 GTGACATAAAGGCACCTGGGAGG + Intronic
1076358797 10:129871978-129872000 GAGAAATAAAGGCCACTAGTGGG - Intronic
1084908968 11:72372348-72372370 GTAAAATAAAGGTTATTGGGAGG - Intronic
1085975416 11:81647476-81647498 GTAAAATAAAAGCCAAGTGGTGG - Intergenic
1087730311 11:101771319-101771341 ATAAAATAAAGGTCAGTGTGTGG - Intronic
1087827335 11:102780636-102780658 ATAAAAGAAAGGCCACTAGGGGG - Intergenic
1088183243 11:107135749-107135771 GTAAAATAAAGCACCTTGGGAGG + Intergenic
1090883059 11:130851433-130851455 ATAAGAAAAAGGCCACTGGTGGG + Intergenic
1091690516 12:2593395-2593417 GTAAAATACAGGCAACTGCCAGG - Intronic
1091769568 12:3142229-3142251 GTAAAATAAAGGCTGCAGTGAGG - Intronic
1092000438 12:5027273-5027295 GGACAATGAAGGCCACTGGGAGG - Intergenic
1100004995 12:89884363-89884385 GTATATTAAATGCCACTGGATGG - Intergenic
1102762171 12:115397433-115397455 GGAAAATACAGGCCACTGCATGG - Intergenic
1105224446 13:18416954-18416976 CTAACATAAAGTCCACTGAGGGG - Intronic
1105293428 13:19069185-19069207 GTAAAAGAAAGGCCATTGGCTGG + Intergenic
1106829293 13:33561819-33561841 GTAAAATAATGGCCCTAGGGTGG - Intergenic
1107350879 13:39513424-39513446 TTCAAATAAAGGCCACTGGAAGG - Intronic
1109245569 13:59950546-59950568 GAAAAATAAAGGGCACTGTGGGG + Intronic
1110509603 13:76333900-76333922 GTTAAAATAAGGTCACTGGGCGG + Intergenic
1110513928 13:76386266-76386288 GTAAAGCAGAGGCCACTGTGAGG - Intergenic
1111816577 13:93161282-93161304 CCAAAATACAAGCCACTGGGTGG - Intergenic
1114008544 14:18341466-18341488 CTAACATAAAGTCCACTGAGGGG - Intergenic
1114042084 14:18688355-18688377 GTAAAGTAAAGGCCCCTGACAGG - Intergenic
1115768807 14:36648896-36648918 ATAAAATAAATGACAGTGGGCGG - Intergenic
1116185875 14:41600214-41600236 GAGAAATAAAGGACACTGTGTGG + Intergenic
1118037555 14:61884130-61884152 GAAAAACAAAGGCCACTGATGGG - Intergenic
1118196164 14:63628665-63628687 TAATAATAAAGGCCACTGGCCGG + Intronic
1119850633 14:77864071-77864093 GTAAAATAAGTTCCCCTGGGAGG - Intronic
1123391750 15:19882049-19882071 CTAACATAAAGTCCACTGAGGGG - Intergenic
1124162505 15:27285745-27285767 GTAAAATTAAGGCCTATGGTGGG + Intronic
1127215643 15:56820691-56820713 GTGAAATAAAATCCACTGAGAGG - Intronic
1130980272 15:88807544-88807566 GTTGAAGAAGGGCCACTGGGAGG + Intronic
1134910106 16:18018088-18018110 CCAAAATAAAGGCCACTATGTGG + Intergenic
1137806859 16:51315150-51315172 GGATAGTAGAGGCCACTGGGAGG - Intergenic
1138481175 16:57304255-57304277 GGAAAAAAAAGTCCCCTGGGTGG + Intergenic
1141128819 16:81420571-81420593 GTAAAATAAAGCCGTATGGGTGG - Intergenic
1141576832 16:84969492-84969514 CTAAAATACAGATCACTGGGTGG + Intergenic
1141943737 16:87296111-87296133 GTAGGATAAAGGGCAGTGGGTGG + Intronic
1142507341 17:372970-372992 GGAAAATACAGGCAACTGAGCGG + Intronic
1143133565 17:4696524-4696546 GTAAGATAAAAGCCACGAGGGGG + Intronic
1143487344 17:7262091-7262113 GTAAAACAAACGACACTTGGGGG + Exonic
1144074047 17:11701150-11701172 GTCACATGAAGGCCACTGTGAGG + Exonic
1145081894 17:19901099-19901121 GTCCAATAAAGGACACTGGAGGG - Intergenic
1148367489 17:47067349-47067371 GAGCAATAAAGGCCACAGGGAGG - Intergenic
1150376057 17:64682641-64682663 ATAAAGGAATGGCCACTGGGGGG - Intergenic
1153373588 18:4349789-4349811 GTAACAGAAAGGCCTTTGGGTGG + Intronic
1154528911 18:15322494-15322516 CTAACATAAAGTCCACTGAGGGG + Intergenic
1158682469 18:59581184-59581206 GAAAAGAAAAGCCCACTGGGAGG + Intronic
1159008065 18:63031289-63031311 ATAAAATCAAGACCTCTGGGAGG + Intergenic
1162993540 19:14319070-14319092 GTAACACCACGGCCACTGGGGGG - Intergenic
1164812532 19:31169078-31169100 ATAACATGAAGTCCACTGGGTGG - Intergenic
1168238885 19:55079519-55079541 GGGAAACAAAGGGCACTGGGAGG + Intronic
925798691 2:7574749-7574771 GTTAAATAAAGGCAACTCTGTGG + Intergenic
929926472 2:46216639-46216661 CTGAAATGAAGGACACTGGGTGG - Intergenic
931242413 2:60465484-60465506 ATAAAATAAAAGCCAGTAGGTGG - Intronic
932446849 2:71786775-71786797 GTCAAAAAAAGGCCCCAGGGAGG - Intergenic
933633658 2:84683380-84683402 GTAGAACAAAGGGCACTGGATGG - Intronic
934151005 2:89147486-89147508 GTAAAACATAGGTCAGTGGGAGG + Intergenic
934216268 2:90034537-90034559 GTAAAACATAGGTCAGTGGGAGG - Intergenic
935217340 2:100984767-100984789 TTGGGATAAAGGCCACTGGGTGG - Intronic
935344953 2:102099334-102099356 CTCAAACAAAGGCCACTGGATGG - Intronic
937086672 2:119176407-119176429 GTAAAATGAAGTCCTATGGGTGG - Intergenic
937683745 2:124672248-124672270 GTAAAATGAGGGCAAATGGGTGG - Intronic
938528014 2:132153899-132153921 CTAACATAAAGTCCACTGAGGGG + Intronic
938651728 2:133390256-133390278 GTAAAATAGAAGACACTGGAAGG - Intronic
940172836 2:150847327-150847349 GTAAAATAAAAGGCTCTGTGAGG + Intergenic
940399832 2:153235557-153235579 GTAAAAAAGATGCCCCTGGGTGG - Intergenic
940419633 2:153464559-153464581 TCAAAATAAAGGCCACTCTGAGG + Intergenic
942934301 2:181535898-181535920 GTAAAATGAACCCCACTGGGTGG + Exonic
943344643 2:186724198-186724220 GTAAAATAAAGAACACTCTGAGG - Intronic
945479185 2:210324459-210324481 GTAAAATGAATGACATTGGGTGG + Intergenic
1168846646 20:949760-949782 GAAAGAAAAAGGCCAGTGGGTGG + Intergenic
1171878026 20:30596572-30596594 GTAAAAGAAAGGCCATTGGCTGG + Intergenic
1175446597 20:59024357-59024379 GGAAAATGCAGGCCACTGTGAGG - Exonic
1175654796 20:60760695-60760717 CTAAAACAAATGCCACAGGGAGG - Intergenic
1176768489 21:13046011-13046033 CTAACATAAAGTCCACTGAGGGG - Intergenic
1177203460 21:17983866-17983888 GGAACATAAAGGAAACTGGGAGG - Intronic
1177937040 21:27361759-27361781 GTAAAATACAGGTCACTGTGTGG + Intergenic
1177953250 21:27565600-27565622 GTGTATTAAGGGCCACTGGGAGG + Intergenic
1178568478 21:33711813-33711835 GTAACATAAATGTCTCTGGGGGG - Intronic
1180433049 22:15272283-15272305 CTAACATAAAGTCCACTGAGGGG - Intergenic
1180515619 22:16140189-16140211 CTAACATAAAGTCCACTGAGGGG - Intergenic
1184325301 22:43778481-43778503 GTTAAATCAGGGCCACAGGGTGG + Intronic
952556577 3:34538270-34538292 GTGAATTAAAAGCCAGTGGGAGG - Intergenic
954824570 3:53361499-53361521 GTAAAATAAAAGAGACTTGGGGG - Intergenic
955193464 3:56783625-56783647 GTAAAATACAGGACTCTGAGAGG + Intronic
958891657 3:99790462-99790484 GTCAAATAAAGGCAATTGGTAGG - Intronic
961365278 3:126395552-126395574 AGAAAATAAAGGCCACATGGGGG + Intronic
961693496 3:128687576-128687598 GTAAAATAAAGGTTACTTGGGGG + Intergenic
963728964 3:148952403-148952425 GTAAAATGAAGTCCAATGGGTGG - Intergenic
964801504 3:160564554-160564576 GTAAAACACAGGCCGCTGGAAGG + Intronic
969364535 4:6686430-6686452 TTAAAATGAAGGTCACAGGGAGG + Intergenic
970068369 4:12125629-12125651 ATAAATTAAAGGCCACTCTGTGG - Intergenic
970560850 4:17280725-17280747 GTAAGTTTAAGGCCTCTGGGAGG - Intergenic
970581305 4:17476663-17476685 GTAAAATAAAGGCCACTGGGGGG - Intronic
971260286 4:25050797-25050819 GTAAAAAACATGCCCCTGGGTGG - Intergenic
977728551 4:100325310-100325332 GAAAAATAAGGGCCAATGTGTGG - Intergenic
977983477 4:103354214-103354236 ATAACAAAAAGGCCACTGTGTGG + Intergenic
979072038 4:116220452-116220474 GTAATATAAAAACCACTAGGAGG + Intergenic
979264262 4:118683132-118683154 ACAACATAAAGGCCACTAGGGGG - Intergenic
981589447 4:146342769-146342791 ATAAAATACAGGGCACTAGGTGG + Intronic
982139528 4:152304755-152304777 TTAGAAAGAAGGCCACTGGGTGG + Intergenic
984447552 4:179856117-179856139 GTAAAATGTCGGCAACTGGGAGG + Intergenic
985386020 4:189449027-189449049 GTAAAATAGAACCCACTGGAAGG - Intergenic
985942406 5:3148713-3148735 GTAACAAAAAAACCACTGGGTGG + Intergenic
986678874 5:10215517-10215539 GTGAAATTAGGGCCAGTGGGTGG + Intergenic
991012868 5:61901922-61901944 GTAAAATGAACTCCACTGAGTGG - Intergenic
992645161 5:78804871-78804893 GTAAAATCAAGGCCACTTGAGGG + Intronic
992706382 5:79398580-79398602 TTATAATTAAGTCCACTGGGAGG - Intronic
993954458 5:94215369-94215391 GCAAAGAAAAGGCCAATGGGTGG + Intronic
994118216 5:96084655-96084677 GGGAAGTAAAGGCCACTGGGAGG + Intergenic
994341141 5:98629459-98629481 GGAAACTAAAGGGAACTGGGAGG + Intergenic
994940880 5:106322246-106322268 ATAAAATATAGGCGACTGGCTGG - Intergenic
997629360 5:135355131-135355153 GTCAGATACAGGCCACTGAGGGG - Intronic
1001749409 5:174117562-174117584 GTTCAAATAAGGCCACTGGGAGG + Intronic
1001763730 5:174228305-174228327 GGAAAATGAAGTCCAGTGGGGGG + Intronic
1003833859 6:10045459-10045481 GTAAAATAAAAGCCCCAGGAAGG + Intronic
1003945418 6:11071019-11071041 GTAAAAAAAAGGCCGATGGAAGG + Intergenic
1007746209 6:44044267-44044289 GAAAAATAAACGGCACTGGTTGG + Intergenic
1009903404 6:69837787-69837809 GCAAAATAAAGGTCACATGGGGG - Intergenic
1010641124 6:78329195-78329217 GGAAAATAAAGTCCACTGAGAGG - Intergenic
1011544148 6:88466073-88466095 GAAAAAGAGAGGGCACTGGGAGG - Intergenic
1011636683 6:89381050-89381072 GCATGATACAGGCCACTGGGCGG + Intronic
1013374810 6:109504056-109504078 ATAAAATAAAGGACACTGCTGGG + Intronic
1015047849 6:128798879-128798901 ATAAAATAAAAGCCACTGACTGG + Intergenic
1015133744 6:129844269-129844291 ATAAAATTAAGTCCACTTGGTGG - Intronic
1016314236 6:142769433-142769455 GTAAAATGAAGGTCAGTGTGGGG - Intronic
1016369470 6:143357215-143357237 ATAAAATAAAGGACACAGAGAGG - Intergenic
1017309423 6:152958586-152958608 GTAAAAAACACACCACTGGGAGG - Intergenic
1019828949 7:3306701-3306723 ATAACATAAAGGCAACTGGTAGG - Intronic
1023124522 7:36942224-36942246 GAATAGTAAAGGCCACTGGGAGG + Intronic
1024847349 7:53662392-53662414 GTAGAATAAAGGTTACTGTGGGG - Intergenic
1026615637 7:71900817-71900839 GTAAAAAACACACCACTGGGTGG + Intronic
1028561376 7:92179527-92179549 GGAAAATAAAGCTCAGTGGGAGG - Intronic
1029360212 7:100082818-100082840 GTAAAAAACACGCCCCTGGGTGG + Intergenic
1032380653 7:131476662-131476684 TTAAAATAAAGGCCAATTTGGGG - Intronic
1032633030 7:133674291-133674313 TTATAGTAAAGCCCACTGGGTGG - Intronic
1033064850 7:138144855-138144877 GTAAAATAATGGCCCCTTGTTGG + Intergenic
1033843380 7:145402691-145402713 GAGAAATAAAGGGAACTGGGGGG - Intergenic
1037320297 8:17634981-17635003 TTAAAAAAAAGGACATTGGGAGG + Intronic
1039819058 8:41120202-41120224 GGAGACTAAAGGCCACTGGGAGG - Intergenic
1040287569 8:46108264-46108286 GTGAAAACAAGGCCACAGGGTGG - Intergenic
1040299570 8:46180885-46180907 GCAAAAACAAGGCCACAGGGTGG - Intergenic
1040317838 8:46274330-46274352 GTGAAAACAAGGCCACAGGGTGG + Intergenic
1041194146 8:55383691-55383713 GAACTTTAAAGGCCACTGGGAGG - Intronic
1041753826 8:61291150-61291172 GTATAATAAAGGGCTATGGGAGG - Intronic
1046446714 8:114330232-114330254 GTAAAATAAAAGGTAGTGGGTGG - Intergenic
1052887285 9:33662220-33662242 GAAAATAAAAGGCCACTTGGCGG - Intergenic
1058388239 9:104463438-104463460 GTTAAATAAAGTCATCTGGGTGG + Intergenic
1058950748 9:109901663-109901685 GTATAATAAAGGCCGTTGTGAGG + Intronic
1059165783 9:112075266-112075288 TTAAAATAACAGCCAGTGGGTGG - Intronic
1059307706 9:113367749-113367771 CTAAAATTAAGGCTTCTGGGGGG + Intronic
1059537163 9:115091723-115091745 TTAAAATAAAGGACTCTAGGAGG + Intronic
1060655424 9:125369350-125369372 GGAAAATAAAAGTCACTGGGAGG - Intergenic
1060732630 9:126048091-126048113 GTGAAATGGAGGCCACTGGGAGG - Intergenic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1187246888 X:17560909-17560931 ATAATTTAAAGGCCACTGGGAGG - Intronic
1187508879 X:19899912-19899934 AAAAAAAAAAGGCAACTGGGGGG - Intergenic
1187967071 X:24622460-24622482 GTAAGATAGAGGCTTCTGGGAGG + Intronic
1188150504 X:26668581-26668603 GTAAAAAAAAGGCCTCTCAGAGG - Intergenic
1189164543 X:38847652-38847674 ATAAAATAAAAGCAGCTGGGTGG + Intergenic
1190874895 X:54452772-54452794 GTAAAATAAAATCACCTGGGGGG + Intronic
1199307364 X:146281843-146281865 GATAAATAAAAGCCACTGTGAGG + Intergenic
1199664867 X:150088598-150088620 GCAAGATAGAGGCTACTGGGTGG + Intergenic
1201674251 Y:16561404-16561426 GTAAAATACACACCCCTGGGTGG - Intergenic