ID: 970585472

View in Genome Browser
Species Human (GRCh38)
Location 4:17510819-17510841
Sequence CCCAGGTCTTCAGAGATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 252}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970585472_970585483 25 Left 970585472 4:17510819-17510841 CCATGCATCTCTGAAGACCTGGG 0: 1
1: 0
2: 0
3: 29
4: 252
Right 970585483 4:17510867-17510889 GCACTGAGCAGATGGGTGGCAGG 0: 1
1: 0
2: 0
3: 31
4: 285
970585472_970585484 29 Left 970585472 4:17510819-17510841 CCATGCATCTCTGAAGACCTGGG 0: 1
1: 0
2: 0
3: 29
4: 252
Right 970585484 4:17510871-17510893 TGAGCAGATGGGTGGCAGGAAGG 0: 1
1: 0
2: 4
3: 114
4: 972
970585472_970585482 21 Left 970585472 4:17510819-17510841 CCATGCATCTCTGAAGACCTGGG 0: 1
1: 0
2: 0
3: 29
4: 252
Right 970585482 4:17510863-17510885 CCAAGCACTGAGCAGATGGGTGG 0: 1
1: 0
2: 2
3: 17
4: 250
970585472_970585485 30 Left 970585472 4:17510819-17510841 CCATGCATCTCTGAAGACCTGGG 0: 1
1: 0
2: 0
3: 29
4: 252
Right 970585485 4:17510872-17510894 GAGCAGATGGGTGGCAGGAAGGG 0: 1
1: 0
2: 4
3: 53
4: 586
970585472_970585478 18 Left 970585472 4:17510819-17510841 CCATGCATCTCTGAAGACCTGGG 0: 1
1: 0
2: 0
3: 29
4: 252
Right 970585478 4:17510860-17510882 TCCCCAAGCACTGAGCAGATGGG 0: 1
1: 0
2: 0
3: 20
4: 265
970585472_970585477 17 Left 970585472 4:17510819-17510841 CCATGCATCTCTGAAGACCTGGG 0: 1
1: 0
2: 0
3: 29
4: 252
Right 970585477 4:17510859-17510881 GTCCCCAAGCACTGAGCAGATGG 0: 1
1: 0
2: 0
3: 19
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970585472 Original CRISPR CCCAGGTCTTCAGAGATGCA TGG (reversed) Intronic
900591583 1:3462647-3462669 GCCAGGTCTTCAGGGCTCCAGGG + Intronic
901048079 1:6410968-6410990 CCCGGGACTTCAAAGCTGCAGGG - Intergenic
901735460 1:11309527-11309549 CCCTGGTCTACAGAGTTTCAGGG - Intergenic
901783744 1:11610976-11610998 CCCTGGTCTTCAGAGCTGCTGGG - Intergenic
901808751 1:11753807-11753829 CCCAGGACTTCAGCCATGGACGG + Intronic
902557068 1:17253231-17253253 TCCAGGTGTTCTCAGATGCACGG + Intronic
903214881 1:21838479-21838501 CCCAGGGCTGCTGAGATGCCTGG + Intronic
903775455 1:25790541-25790563 CCCAGGTCTTAGGACCTGCATGG + Intergenic
903947359 1:26972174-26972196 CCCAAGTCTACAGGGATGAAGGG + Intergenic
904057324 1:27680026-27680048 CCCTGGATTTCAGAGTTGCATGG - Intergenic
905284833 1:36872466-36872488 CACAGGTCTGCAGACATACACGG + Intronic
906335811 1:44929745-44929767 CCCAGGACATCAGTGATTCAAGG - Intronic
907282963 1:53362850-53362872 CCCAGTTCTTCAGAGTTGTCAGG - Intergenic
907516449 1:54996311-54996333 CACAGGGCTTCAGGGATGGATGG - Intergenic
909375250 1:74933534-74933556 CCCCGGCCTTCAGAGATGCCTGG - Intergenic
909761627 1:79295228-79295250 CCCAAGTTTTCAAAGAGGCATGG - Intergenic
910757631 1:90709014-90709036 TCCAGGTTTTCTGAGAAGCAAGG - Intergenic
911175134 1:94810963-94810985 CCCTGCTCTTCAGAGGTACAAGG + Intergenic
914917977 1:151830079-151830101 ACCAGGGCTTCAGAGATGTGGGG + Intronic
915018489 1:152758750-152758772 CCCAGCTCTTCTTAGAGGCAAGG - Intronic
915396018 1:155584814-155584836 CCCAGGTGTTCAAGGCTGCAGGG - Intergenic
915498584 1:156298875-156298897 CTTGGCTCTTCAGAGATGCAAGG - Exonic
916420832 1:164636211-164636233 CTCAGGTCTACAGAGATGGAAGG + Intronic
918211896 1:182358544-182358566 CCAAGCTTTTCAGAGAGGCAGGG + Intergenic
918463832 1:184801708-184801730 TCCAGGACTTCAGGGATGCTGGG + Intronic
920252205 1:204629194-204629216 CCCATGCCTTCACACATGCAGGG + Intronic
921282939 1:213585314-213585336 CCCAGGGCTCCGGGGATGCATGG + Intergenic
921667074 1:217885555-217885577 CACAGATCATCAAAGATGCATGG + Intergenic
923074510 1:230597795-230597817 GACAGGAGTTCAGAGATGCAAGG - Intergenic
924128187 1:240877807-240877829 CACAGGTCTTGAAAGGTGCATGG - Intronic
1064471654 10:15641604-15641626 CCCAGGTCTACCAAGATGCATGG + Intronic
1065837030 10:29667777-29667799 CCCAGGACTTTAAAGATGCAGGG + Intronic
1066167164 10:32800192-32800214 TCAAGGTCTTGAAAGATGCAGGG - Intronic
1066260786 10:33727846-33727868 CCCAGGTCAACAGAGAGGAAAGG - Intergenic
1066341832 10:34541950-34541972 CCCAGGACTTCAAGGCTGCAGGG - Intronic
1068275012 10:54783596-54783618 CCCAAGTCTTCAGAGAGATATGG + Intronic
1070065898 10:73034136-73034158 CCCAGGAGTTCAAGGATGCAGGG + Intronic
1071301958 10:84262455-84262477 CCCAGTTCTCCAGGGCTGCACGG - Intergenic
1071826701 10:89332589-89332611 CCCAGCTTTTCAGAACTGCAGGG + Intronic
1071950920 10:90701877-90701899 CCAAGGACTTGAAAGATGCAAGG - Intergenic
1072752167 10:97989047-97989069 CCCAGCTCTGCAGTGAGGCAGGG - Intronic
1074892952 10:117750536-117750558 CCTAGGTCTTCAGAGCATCATGG - Intergenic
1074920364 10:118002655-118002677 CCCAGGACTTCAGGGATGATGGG - Intergenic
1075955738 10:126521151-126521173 CCCAGGTCTTTAGAGATACCTGG + Intronic
1076184397 10:128434986-128435008 GCCAGGTCTACAGAGACGCAGGG - Intergenic
1076588917 10:131570140-131570162 CCCAGCTCCACAGAGATGAAAGG + Intergenic
1077380838 11:2236609-2236631 CCAAGGACTTGAGAGGTGCAGGG + Intergenic
1077384718 11:2263482-2263504 CACAGGTATCCAGAGGTGCAAGG - Intergenic
1077401039 11:2357583-2357605 CCAAGGACTTGAGAGGTGCAGGG + Intergenic
1078042851 11:7884362-7884384 CCCAAGAGTTCAGGGATGCAGGG + Intergenic
1078719182 11:13868652-13868674 CCAAGATTTTCAGAGAGGCAAGG - Intergenic
1081740425 11:45435691-45435713 CCCAGGTCTTGAGAGGTGTGAGG + Intergenic
1082076170 11:47977968-47977990 CCCAGGTCTCCACAGATTCATGG - Intergenic
1083330497 11:61896178-61896200 CCTAGGTCTTCAGTGTTGCTGGG + Intergenic
1084399661 11:68936337-68936359 CCAGGGTCTTCAAAAATGCATGG - Exonic
1085400442 11:76232686-76232708 CCCAAGCCTCCACAGATGCAGGG - Intergenic
1086154181 11:83647516-83647538 CCCATGTCTTCAGATACCCAAGG + Intronic
1086278495 11:85159492-85159514 CCAAGGACTTGAAAGATGCAGGG + Intronic
1087042728 11:93817587-93817609 CCCAGCTCTTCAGAATTGTAGGG + Intergenic
1087121680 11:94581549-94581571 CCAACGTCTTCAGTGATCCATGG - Intronic
1090137103 11:124209981-124210003 CCCAAGTCTGCAGAGATGCCTGG + Intergenic
1091008591 11:131977127-131977149 CCCATCCCTTCAGAAATGCATGG + Intronic
1091236693 11:134026872-134026894 CCAAGGTGCTCAGACATGCATGG - Intergenic
1092397189 12:8137392-8137414 CCCAAGTCTTCTGAGTTGCTAGG + Intronic
1093424919 12:19017972-19017994 CCCTGGTTTTTAGAGATGGATGG - Intergenic
1094449280 12:30567193-30567215 GAGAGGACTTCAGAGATGCAGGG - Intergenic
1095487944 12:42703789-42703811 CTCAGCTCCTCAGAGATGCCAGG - Intergenic
1097895824 12:64824417-64824439 CCCAGATCTTGGGAGAAGCACGG + Intronic
1100844679 12:98645634-98645656 CCCGGGGCTGCAGAGATCCAGGG + Exonic
1101340601 12:103839650-103839672 TGCAGGTCTTAAGAGATGAAAGG - Intronic
1101764794 12:107687688-107687710 CCCAGGAGTTCACAGCTGCAGGG + Intronic
1102086013 12:110140565-110140587 CCCATGTAATTAGAGATGCATGG - Intronic
1102690673 12:114758091-114758113 CACAGGTCATAATAGATGCAGGG + Intergenic
1103799695 12:123529796-123529818 TCCAGGTGTTCAGGGCTGCAGGG + Intronic
1104873063 12:132014486-132014508 CCGAGGTCTTCAGATGTGCATGG + Intronic
1105220611 13:18322859-18322881 ACCAGGACTTCAGAGAGGAATGG - Intergenic
1108240428 13:48457923-48457945 CCCAAGTATACAGAGATGCCTGG + Intronic
1108914418 13:55589856-55589878 CCAAGGTCTTGAAAGATGAAGGG - Intergenic
1110883058 13:80597281-80597303 CCCAGATCTTCAGAGGCGGAAGG + Intergenic
1112268150 13:97944745-97944767 CACAGGACTTCAGACCTGCAAGG + Intergenic
1112495501 13:99900733-99900755 CCCAGTTCATCAGTGCTGCAGGG + Intergenic
1113321543 13:109237066-109237088 CCCAGGACTGCAGAGCTGCTTGG + Intergenic
1114988521 14:28261166-28261188 CCCAGGCTTGCAAAGATGCATGG - Intergenic
1115129005 14:30031208-30031230 CCTAGTTAGTCAGAGATGCATGG + Intronic
1115473157 14:33789378-33789400 CCCTGGGCTTCAGAGGAGCAAGG + Intronic
1116750986 14:48883138-48883160 CCCAGGAGTTCAAGGATGCAGGG - Intergenic
1117691731 14:58314499-58314521 CCCAAGAGTTCAGGGATGCAGGG - Intronic
1119411884 14:74437174-74437196 CCCAGGACATCAGAGCTGCAAGG - Intergenic
1120823397 14:88933486-88933508 CCCTGCTCTTCTGAGATGGAGGG - Intergenic
1121854434 14:97253927-97253949 CCCAGGACTACAGAGACACAAGG - Intergenic
1122589977 14:102841720-102841742 ACCAGGTATGCAGAGAAGCAAGG + Intronic
1122811444 14:104291360-104291382 CCCAGGTCTACAGATCTCCAGGG - Intergenic
1127301473 15:57658295-57658317 TCCATATGTTCAGAGATGCACGG - Intronic
1130051909 15:80490688-80490710 ACCAGGTCTTCACAGATGAAGGG + Intronic
1130371374 15:83287574-83287596 ATCAGCTCTTCTGAGATGCAGGG + Intergenic
1131090858 15:89624116-89624138 CCCATGTCCTCAGAGCTGCTCGG + Exonic
1137038956 16:35592027-35592049 TTCAGGTGTTCAGAGATCCATGG - Intergenic
1140680481 16:77380049-77380071 CCGAGGTCCTCAGAAATGCTTGG + Intronic
1141600955 16:85126149-85126171 CCCAGTTCTTCAGCAAAGCAAGG + Intergenic
1143145141 17:4770352-4770374 CCCAGGTGGTCAGGGCTGCAGGG + Intergenic
1143649732 17:8256008-8256030 CCCAGGCCCTCAGAGACTCAGGG - Intronic
1143888758 17:10086391-10086413 TCCTGGCCTTCAGAGTTGCAGGG - Intronic
1146008626 17:29177904-29177926 CACAGGTCTTCAGGGCAGCAGGG - Intronic
1147718897 17:42526185-42526207 CCCAGTTCATCAGAGAGACATGG - Intergenic
1148077861 17:44949580-44949602 CCCTTGTCTTCTGAGATCCAAGG - Intergenic
1149362591 17:55910959-55910981 CCCAGGAGTGCAGAGATGCCTGG + Intergenic
1150301616 17:64051935-64051957 CTGAGGTCTTCAGGGATGAAGGG + Intronic
1154144730 18:11857626-11857648 CCCAGGTGATCAGTGATTCATGG - Intronic
1155399754 18:25425139-25425161 CCCTGGTCTTCTGATATGCTGGG - Intergenic
1157131447 18:45011372-45011394 CCCAGGGCTTCAGAGAGACTAGG + Intronic
1157581853 18:48778340-48778362 CCCAGGTCTGCAGGAGTGCAGGG + Intronic
1158251901 18:55498654-55498676 CCCACGCCATCAGAGATACAAGG + Intronic
1160250329 18:77198014-77198036 CCCAGGTGTGCAGAGAGGAAAGG + Intergenic
1160398375 18:78588988-78589010 CCAATGTCTTCAGAAATGCTGGG - Intergenic
1160530028 18:79557309-79557331 CCCAGGTCTACAGAGAGGGCAGG + Intergenic
1161467324 19:4438562-4438584 CCTAGGGCTTCACAGATACATGG - Intronic
1163290043 19:16373297-16373319 CCCAGGGCTTCCCAGATGCTGGG - Intronic
1163319670 19:16566640-16566662 TCCAGGTCTTGCGAGATTCACGG - Exonic
1163845388 19:19635563-19635585 CCCAGGTCTGCAGGGAGACAGGG + Exonic
1164558991 19:29275597-29275619 CCCAGGTCTTCAGGCATAAAGGG + Intergenic
1164617347 19:29674983-29675005 CCCAGGTCTCCAGACATCTAGGG + Exonic
1165365340 19:35361855-35361877 CCCTGGGCTTCTGAGATGTATGG - Intergenic
925855281 2:8123625-8123647 TCCAGCTCTTCAGGGAGGCAGGG + Intergenic
927515320 2:23668775-23668797 CCCAGACCCTCAGAGGTGCATGG + Intronic
927894823 2:26775005-26775027 CCGAGGACTTCAGAGCTGGAAGG - Intronic
928751912 2:34480327-34480349 CCCTGTTCTTTAGAGATGAATGG - Intergenic
929483310 2:42333461-42333483 CCCAGGTGTTCAGGGATACAGGG + Intergenic
931932844 2:67160464-67160486 CCGAGGCCTACAGAGATGCTGGG - Intergenic
932485074 2:72079816-72079838 CCCAGGACTTCACAGAGGAAGGG + Intergenic
935564444 2:104591230-104591252 TCAAGGTCTTGAAAGATGCAGGG - Intergenic
935943028 2:108261498-108261520 ACCAGGTCTTCACTGGTGCATGG - Intronic
938169284 2:129060555-129060577 CCCAGGACTTCAGAGTTACAGGG - Intergenic
938555329 2:132418281-132418303 CCAAGTTCTGCAGAGATACAGGG + Intronic
939713206 2:145549469-145549491 TCCAGGTCCACAGAGTTGCAAGG + Intergenic
939909695 2:147964548-147964570 CCCAGTTCTTGAGAGAGGAATGG + Intronic
942430275 2:175903609-175903631 CTCATCTTTTCAGAGATGCATGG + Intergenic
942505843 2:176640705-176640727 CTCAAGTCTTCAGTGATGAAAGG + Intergenic
943828337 2:192425682-192425704 CCCAGGACTTGGGAGATGTAGGG - Intergenic
944590261 2:201210307-201210329 CCCAGGAATTCAGAGATGAGTGG - Intronic
947039831 2:225904370-225904392 CCCAGGACTTCAAAAATTCAAGG - Intergenic
947957259 2:234202880-234202902 CCCAGGAGTTCAAAGCTGCAGGG - Intergenic
1169267386 20:4174883-4174905 TCCAGGTCCTCAGAGAGGGAGGG + Intronic
1171410075 20:24940557-24940579 CAGAGGTCTTCAAAGATGCTGGG + Intergenic
1171425341 20:25045301-25045323 CCCAGGTCCTCTGGGGTGCAGGG - Intronic
1171784328 20:29448811-29448833 CCCAGGTCGCCAGGGCTGCATGG - Intergenic
1173607132 20:44339379-44339401 CCCAGGAAGTCAGAGATGGAAGG + Intronic
1175540193 20:59743447-59743469 CCCAGGGCTTCAGGGAGGCCAGG - Intronic
1175872421 20:62214735-62214757 GCCAGGTCTTGAGAAGTGCAGGG + Intergenic
1178952235 21:36994529-36994551 CCCAGTTTTTAAGAGCTGCACGG - Intergenic
1182078837 22:27514545-27514567 CCCAGGGCCTCAGAGACACAAGG - Intergenic
1182637305 22:31738483-31738505 CAAAGGTCTTCAGAGATCCAGGG - Exonic
1184539726 22:45112826-45112848 CCTACGCCTTCAGAGTTGCAGGG - Intergenic
1184837294 22:47031574-47031596 CGCAGGTGCCCAGAGATGCAAGG + Intronic
1185089241 22:48756666-48756688 CGCAGGGATGCAGAGATGCAGGG + Intronic
1185103300 22:48853185-48853207 CCTTGGGCTTCAGAGGTGCATGG - Intergenic
1185111719 22:48903874-48903896 CACAGTTCTTCAGAGAACCAGGG - Intergenic
950118327 3:10465358-10465380 CCCAGGGCTTCAGAGAAAGAAGG - Intronic
950905241 3:16531568-16531590 TCCAAGTCTTCAGGGATGCACGG - Intergenic
951227834 3:20141910-20141932 GCCAGCTCTTCAGAGAGACAGGG - Intronic
951464841 3:22990505-22990527 CCAAGGTCTTCAGGGTTGCGGGG - Intergenic
951841282 3:27036579-27036601 CCCTGATCTTCAGAGATGGAAGG + Intergenic
953014977 3:39065251-39065273 TACAGGCCTTCAGAGATGAAAGG - Intronic
954929619 3:54269703-54269725 ACCAGGTGTCCAGAGATGAATGG + Intronic
955002402 3:54939490-54939512 CCCATTTCTTCAGGGAGGCAGGG + Intronic
955110077 3:55940232-55940254 CCCAGGATTTCAGAGTTGAAAGG + Intronic
955459015 3:59159137-59159159 CACATTTCTTTAGAGATGCAGGG - Intergenic
956245159 3:67174790-67174812 TCTATGTCTTCAGAGATGAAAGG - Intergenic
956350386 3:68328778-68328800 TTCTGCTCTTCAGAGATGCAAGG - Intronic
958034143 3:88150068-88150090 CTCAGCTTTTCAGAGATGGAGGG + Exonic
960182366 3:114595626-114595648 CCCAGGTTTCCAGATATCCAAGG - Intronic
960414623 3:117369144-117369166 CCCAGTACTTCAAAGATGCTCGG + Intergenic
960432302 3:117584057-117584079 CCCAGGAGTTCATAGTTGCAAGG - Intergenic
960951887 3:123004631-123004653 CCCAGCTCTCCAGAGAAGCTGGG - Intronic
963049025 3:141126333-141126355 CCCAGGGCCTCAGGGATGAAAGG - Intronic
963420771 3:145058235-145058257 CCCAAATCTTCAGACATGAAGGG - Intergenic
963512698 3:146268712-146268734 CCCAGTTGTTCTGAGAAGCAGGG - Intergenic
965921969 3:173927913-173927935 ACCAGGTCTTCAGAGAAGTAAGG - Intronic
967569981 3:191017043-191017065 TCCAGGTCTGTAGACATGCAGGG + Intergenic
967775220 3:193379262-193379284 CCAGGGTCTTCAGTGAAGCACGG - Intergenic
969328158 4:6455881-6455903 AGCAGGTGGTCAGAGATGCAAGG - Intronic
969884535 4:10203679-10203701 CACAGGTCTGCACAGATGCACGG - Intergenic
969905079 4:10386330-10386352 CGCAGGTTTTCACAAATGCATGG + Intergenic
970370408 4:15400141-15400163 CACAGGAATTCAGAGATGCAAGG + Intronic
970585472 4:17510819-17510841 CCCAGGTCTTCAGAGATGCATGG - Intronic
971101143 4:23467393-23467415 CCAAGGACTTGAAAGATGCAGGG - Intergenic
971280195 4:25236658-25236680 CTCAGGTCTTCAGAGGTAAATGG + Intronic
973118318 4:46488067-46488089 CCAAGGACTTGAAAGATGCAGGG + Intergenic
974583457 4:63837100-63837122 CACAGGTCTTCAGGGAAGAAGGG + Intergenic
976657711 4:87506650-87506672 CTCAGGTCTTCAGACTTGAACGG + Intronic
977643097 4:99379396-99379418 CCCATGTCTTCAGAGAGAAATGG + Intergenic
978557812 4:109999639-109999661 CAGAGGTCATCAGAGATGCCTGG - Intronic
980113885 4:128660670-128660692 CCAAGGACTCCAGATATGCAGGG + Intergenic
982266884 4:153545957-153545979 CCCAGGAGTTCAAAGCTGCAGGG - Intronic
984380164 4:178982709-178982731 CCCTGGTCTTTAGGGATTCAGGG - Intergenic
984658075 4:182341503-182341525 CCCATGTCTTCGGATCTGCAGGG - Intronic
984801271 4:183719233-183719255 CCCTGCTCTGCAGAGGTGCAGGG - Intergenic
985257109 4:188081278-188081300 CCTAGGTCTACAGTGATGTAGGG - Intergenic
989103819 5:37842432-37842454 CCCAGGTCTGCGGATATACAGGG - Intergenic
991056136 5:62322790-62322812 ACCAGGCATTAAGAGATGCATGG + Intronic
991727769 5:69553050-69553072 CCCAGGAGTTCAAAGCTGCAGGG + Intronic
991867188 5:71074824-71074846 CCCAGGAGTTCAAAGCTGCAGGG - Intergenic
992325128 5:75652761-75652783 CCCTGTCATTCAGAGATGCATGG - Intronic
993023369 5:82618559-82618581 CACAGGTCTTCAGTCATGAATGG - Intergenic
994420732 5:99524954-99524976 CCGAGGTCACCAGGGATGCATGG - Intergenic
994486311 5:100389360-100389382 CCGAGGTCACCAGGGATGCATGG + Intergenic
994613639 5:102077472-102077494 CCCATGTTTTCAGAGGTCCATGG - Intergenic
996392313 5:122974723-122974745 TCAAGGACTTGAGAGATGCAGGG - Intronic
998228173 5:140342693-140342715 CCCATGTCTTCGGAAATACAAGG - Exonic
998321339 5:141235396-141235418 CCCACGTCTCCAGAGATGTACGG + Intergenic
999281482 5:150369320-150369342 CCCAGGGCCTCAGAGATGTGTGG + Intronic
1002096479 5:176834299-176834321 CCCAGCCCTACCGAGATGCATGG + Intronic
1002690211 5:181045232-181045254 CCCAGGTTCACAGAGCTGCAAGG - Intronic
1002827436 6:786019-786041 CCCAGGACTTCAGGGAGGCAGGG + Intergenic
1006170613 6:32089849-32089871 CCCAGGTAGTCAGAGTTGCCAGG - Intronic
1006393608 6:33773032-33773054 CCCAGGTCTCCAGGTGTGCAGGG + Intronic
1007990576 6:46251180-46251202 CCCAAGGCTTAAGAGATGAAGGG - Intronic
1008108469 6:47466401-47466423 CCCAGGAATTCAAAGCTGCAAGG - Intergenic
1008141019 6:47832108-47832130 ACCAGGGCTTCAGAAATGAATGG + Intronic
1009770454 6:68137818-68137840 CCAAGGACTTCAAAGATGCAGGG - Intergenic
1011603012 6:89077518-89077540 CCCAGGTGGTCACAGCTGCAAGG + Intergenic
1012995589 6:105970098-105970120 CCCAAGTCCTCACAGATGAATGG - Intergenic
1016571332 6:145516373-145516395 TCTAGGTCCTCAGAGAGGCAAGG - Intronic
1017120634 6:151020825-151020847 TCCATGTCTGCAGGGATGCAGGG + Intronic
1017227935 6:152042061-152042083 TCAAGGACTTCAAAGATGCAGGG - Intronic
1017868262 6:158463733-158463755 CTCAGCTCATCAGAGAGGCAGGG + Intronic
1018638614 6:165886399-165886421 TCCAGGGCTGCAGAGCTGCAGGG - Intronic
1018698786 6:166411348-166411370 CGCCGCTCTTCAGTGATGCAGGG + Exonic
1019538000 7:1538822-1538844 CCCAGGTCTGCAGGGCAGCAGGG + Intronic
1019901134 7:4021529-4021551 CCGAGGTCATCAGAGATTCAGGG + Intronic
1020269951 7:6589093-6589115 ACCAGGACTTCAGAGATGCCCGG - Exonic
1023034268 7:36116966-36116988 CCCAGGTCATTTGAGATTCAGGG + Intergenic
1025165960 7:56712554-56712576 TCCAGTTCTTGAGAGATGAATGG - Intergenic
1028323329 7:89490500-89490522 TGCAGGTATTCAGATATGCAAGG - Intergenic
1028432314 7:90761780-90761802 CCCTGGTCTTAAGAAATGCATGG + Intronic
1028499585 7:91504065-91504087 GCAAGGTCTTCATACATGCAAGG + Intergenic
1030277331 7:107735143-107735165 TCAAGGACTTCAAAGATGCAGGG + Intergenic
1034161101 7:148994851-148994873 CCAAGGTCCTCAGAGAGGGAGGG - Intergenic
1040763505 8:50878285-50878307 CTGAGGTCTTCTGAGAAGCAAGG - Intergenic
1041030405 8:53730607-53730629 CCCACGTATTCAGGGCTGCAGGG + Intronic
1043737716 8:83768597-83768619 CCGAGGGCTGCAGAGATGAAAGG - Intergenic
1045684001 8:104692403-104692425 TCCAGGTCTGCAGATCTGCAAGG - Intronic
1046733137 8:117747661-117747683 CCCTTGTCCTCAGAAATGCAAGG - Intergenic
1048108571 8:131441006-131441028 TCCAGCTCTTCTGAGCTGCATGG + Intergenic
1048182195 8:132205830-132205852 CCCTGGTCTTCCTAGAAGCAGGG - Intronic
1048676074 8:136782052-136782074 CCCAAGTCATCAGAGAAACATGG + Intergenic
1049192074 8:141294119-141294141 CCCTGGTCTACAGAGATCCTGGG - Intronic
1049595183 8:143480150-143480172 CCCAGGACTTCAGTGGTGCTGGG + Intronic
1051012408 9:12433485-12433507 CCCAGGACCTGAGAGATGCATGG - Intergenic
1052315554 9:27113061-27113083 CTCAGGTCTTCAGTGCTTCATGG - Intronic
1052469352 9:28874689-28874711 CCAAAGTCTTCAGAGCTGGAAGG - Intergenic
1053316471 9:37056073-37056095 TCCATGTATTCAGTGATGCAGGG - Intergenic
1053607752 9:39678627-39678649 CCCAGGATTGCAGAGATCCATGG - Intergenic
1053865600 9:42434987-42435009 CCCAGGATTGCAGAGATGCATGG - Intergenic
1054245783 9:62663782-62663804 CCCAGGATTGCAGAGATCCATGG + Intergenic
1054559908 9:66698313-66698335 CCCAGGATTGCAGAGATCCATGG + Intergenic
1055915048 9:81392171-81392193 GCCAGGCCTTCAGTGGTGCATGG - Intergenic
1056664604 9:88571759-88571781 CCCAGGTGTTCAAGGATTCATGG - Intronic
1056715745 9:89026799-89026821 CCCAGGTGTGCAGGGATTCAAGG - Intronic
1057084053 9:92192416-92192438 CCCAGATCTACAGAGAGACAAGG - Intergenic
1057149263 9:92781913-92781935 CACAGGTTTTCAAAGATGCCGGG - Intergenic
1057435045 9:95032281-95032303 GCCAGGTGTTCACAGGTGCAGGG + Intronic
1059153789 9:111972179-111972201 CCCAGGACTTCAAGGCTGCAGGG + Intergenic
1059653378 9:116335232-116335254 CCCAGGAATTCAGAGACTCATGG - Intronic
1059850627 9:118334749-118334771 TCTAGATCTTCAGAGCTGCAAGG + Intergenic
1059876503 9:118641267-118641289 CCACGGTCTGCAGAGTTGCAGGG - Intergenic
1059998556 9:119937479-119937501 CCCAGTTTATCAGAGATGGAGGG + Intergenic
1062043081 9:134412934-134412956 CCCAGTCCTTCAGAGCTGGAGGG - Intronic
1062096435 9:134706274-134706296 CCCAGGTTTCCAGAGGTGCTGGG + Intronic
1062229157 9:135471695-135471717 CCCAGGTCTCCATGGAGGCAGGG - Intergenic
1062519242 9:136950829-136950851 CCCAGGACTTCAGGGCTCCAGGG - Intronic
1187798957 X:23038370-23038392 CACAGGTCTTCAGATATCCAGGG - Intergenic
1188412141 X:29885741-29885763 CCCAGGTGTTCGAGGATGCAGGG + Intronic
1188537999 X:31218816-31218838 GCCAGGTCTTCAGAAATAAAGGG - Intronic
1192695600 X:73412293-73412315 CCCAGGATTTCAGAGCTGAAAGG - Intergenic
1193207143 X:78762514-78762536 CCCAGGCCCTCAGAGAGGGAAGG - Intergenic
1193912841 X:87327198-87327220 CCAGGGTTTTCAGAGATCCAGGG - Intergenic
1194209360 X:91051878-91051900 CCCAGGTGTTCAGGGATACCTGG - Intergenic
1195501582 X:105607600-105607622 ACCAGGTATTAAAAGATGCATGG + Intronic
1196846950 X:119904017-119904039 CCCAGGAGTTCAAAGCTGCAGGG - Intronic
1197867610 X:131035807-131035829 CTCTGGCCTTCAGAGATACATGG - Intergenic
1199330752 X:146555431-146555453 GACAGGTCTTCACAAATGCAGGG - Intergenic
1200526372 Y:4279085-4279107 TCAAGGACTTGAGAGATGCAGGG - Intergenic