ID: 970587033

View in Genome Browser
Species Human (GRCh38)
Location 4:17523991-17524013
Sequence AAATCTCACCACATCCCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970587031_970587033 7 Left 970587031 4:17523961-17523983 CCTGGAGATTTTGCATGCATTGC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 970587033 4:17523991-17524013 AAATCTCACCACATCCCTATGGG 0: 1
1: 0
2: 3
3: 28
4: 201
970587029_970587033 28 Left 970587029 4:17523940-17523962 CCACTAAGGGCTGGGCAGGGACC 0: 1
1: 0
2: 1
3: 26
4: 234
Right 970587033 4:17523991-17524013 AAATCTCACCACATCCCTATGGG 0: 1
1: 0
2: 3
3: 28
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970587033 Original CRISPR AAATCTCACCACATCCCTAT GGG Intronic
901864758 1:12097464-12097486 AATCCTCACCACAGCCCTAGGGG + Intronic
902914039 1:19625135-19625157 AAATCTCACAACAACACTATAGG - Intronic
905350444 1:37342445-37342467 AAGTCTCACAACAGCCCTGTGGG + Intergenic
905944080 1:41887428-41887450 AAATCTCAACCCATCCCTGGAGG + Intronic
906944811 1:50286619-50286641 CAAGCTCACCACAACCCTTTAGG - Intergenic
907855748 1:58301864-58301886 AATTCTTACCACAACCCTATAGG - Intronic
909057393 1:70837756-70837778 AAATCTCACAACAACCTTGTAGG + Intergenic
910395416 1:86788885-86788907 TAGTCTGACCACTTCCCTATGGG + Intergenic
911564881 1:99452168-99452190 CATGCTCACCACATCTCTATTGG - Intergenic
912203972 1:107490281-107490303 AATTCTCACCACAACCCTTCTGG - Intergenic
912411101 1:109481181-109481203 AAATCTCACCCTTTCCCCATCGG - Exonic
912569186 1:110608832-110608854 AAACCTCACCACACCCTTAGGGG - Intronic
912645147 1:111385169-111385191 AGATCTCAACACATCTATATGGG - Intergenic
912788444 1:112627029-112627051 TTATCTCACAACATCCTTATAGG + Intronic
916307497 1:163354837-163354859 AATTCTTAGCACATCCATATAGG + Intronic
916599856 1:166282288-166282310 AGATTTCACCCCTTCCCTATGGG - Intergenic
917053340 1:170950025-170950047 AATTCTCACAACAGCCCTGTGGG + Intronic
917660734 1:177174595-177174617 AAATCCCACCGCATCCCTCATGG - Intronic
919481502 1:198095837-198095859 AATCCTTACCACACCCCTATGGG - Intergenic
919560559 1:199113661-199113683 AAGTCTTACCACATTCCTTTTGG - Intergenic
919610446 1:199739515-199739537 TATTCTTACCACATCCCTATGGG - Intergenic
922517170 1:226216270-226216292 AACTCTCCCCACATCGCTACAGG - Intergenic
1064343321 10:14506875-14506897 AATTCTCACCATATTCCTATGGG - Intergenic
1064896414 10:20242421-20242443 AATTCTCACATCAACCCTATGGG + Intronic
1065236546 10:23658232-23658254 AAATCTCACCTCTTCCCTTTGGG + Intergenic
1066594340 10:37033026-37033048 AATTCTCACAATAACCCTATGGG + Intergenic
1067268580 10:44769844-44769866 AAATCTCATCACAGCCCACTGGG + Intergenic
1067934266 10:50595492-50595514 AATTCTCTCCACATCTCTACCGG + Intronic
1068027712 10:51668570-51668592 AACCCTCACCACATCACCATAGG - Intronic
1069114268 10:64485081-64485103 AATTCTCACCACAGCATTATGGG - Intergenic
1070502890 10:77088282-77088304 AAATCTCAAAACAACCCTATAGG + Intronic
1070824201 10:79381336-79381358 AAGTCAAAGCACATCCCTATGGG - Intergenic
1071465788 10:85938503-85938525 AACTCTCACAACAACGCTATGGG + Intronic
1072616867 10:97056045-97056067 TAATCTCATAACAACCCTATGGG + Intronic
1072681199 10:97508100-97508122 AATTCTCACAACCACCCTATGGG + Intronic
1072820619 10:98553442-98553464 CAGTCTCACCAAATCCCTAGGGG + Intronic
1072917579 10:99548647-99548669 GATCCTCATCACATCCCTATAGG - Intergenic
1073815163 10:107198297-107198319 AAACCACACCATATCCTTATAGG + Intergenic
1074281072 10:112052186-112052208 AATGCTCACAACAGCCCTATAGG + Intergenic
1074370090 10:112893709-112893731 AAATCTCTCCACAGCCCTCTTGG + Intergenic
1076619034 10:131775294-131775316 AAAACTCACCACATCTTTAATGG + Intergenic
1079594883 11:22231048-22231070 AAATCTCACCACACCTCTTATGG + Intronic
1079823713 11:25163990-25164012 AAATCTCACAATACCTCTATGGG + Intergenic
1080478843 11:32624469-32624491 TAATCTGTCCACTTCCCTATTGG - Intronic
1081563734 11:44242928-44242950 AATCCTCACAACAACCCTATGGG - Intronic
1082051138 11:47771268-47771290 AAATTTCACAACAACCCTATGGG - Intergenic
1085132516 11:74053544-74053566 TAATATCAGCACATCCCTCTTGG + Intronic
1085281424 11:75333620-75333642 AAGCCTTACCACAACCCTATGGG + Intronic
1085894123 11:80616850-80616872 AATTCTCACAAGAACCCTATGGG - Intergenic
1086092940 11:83021786-83021808 AAATCTCACAACAGCCCTTGAGG - Intronic
1087488075 11:98784437-98784459 AACTCTCATTACATCACTATTGG - Intergenic
1088087631 11:106000534-106000556 AATTCTCACAACATCCCTTAAGG - Intronic
1088188686 11:107203101-107203123 AATTCTCACTACAGCCCTATGGG + Intergenic
1088300206 11:108350179-108350201 AAATCATACAACAACCCTATTGG - Intronic
1090498697 11:127240445-127240467 GATTCTCACCACATCCATCTAGG + Intergenic
1091138567 11:133215929-133215951 TAATCTCACCTCCTCACTATTGG + Intronic
1095631360 12:44380645-44380667 AATTCTCACAACAACCCTATGGG - Intronic
1096673028 12:53211390-53211412 AAATCTCAGCACTGCCCCATGGG - Exonic
1096887482 12:54732179-54732201 AAATATCACCAAATCTCTAGAGG + Intergenic
1097187696 12:57204516-57204538 AAATCTCACCACACTCCTCGGGG - Exonic
1097745052 12:63292362-63292384 AACTCTCACCATAAACCTATGGG - Intergenic
1098602669 12:72350805-72350827 AAAACTCATAACATCCCTAGCGG + Intronic
1099201645 12:79684985-79685007 AATTCTCACCACAGCCCTATGGG - Intronic
1099658314 12:85523777-85523799 CAATCTCATAACAACCCTATGGG + Intergenic
1102375402 12:112417915-112417937 AAATCCCAGCACTTCCCTTTGGG - Intronic
1102545782 12:113654339-113654361 AATCCTCACCACAGCCCCATGGG + Intergenic
1107204146 13:37761622-37761644 AATCTTCACCACAGCCCTATGGG - Intronic
1108025288 13:46171163-46171185 AATTCTCACCACAATCCTATAGG + Intronic
1108076130 13:46681433-46681455 AATTCTCACCACAAACCCATTGG - Intronic
1109864748 13:68248450-68248472 AATTCTAACCACATCGTTATTGG - Intergenic
1116732956 14:48648286-48648308 AAATCTCTCCATTTCCATATTGG + Intergenic
1117164798 14:53022544-53022566 AAATCTCACCAAATTTCTGTAGG + Intergenic
1119860202 14:77930687-77930709 AATCCTCACAACAACCCTATCGG - Intronic
1121401155 14:93678398-93678420 AAATATCAGCAGTTCCCTATGGG - Intronic
1123893601 15:24806122-24806144 AAACCTCACAACATCCCAAGAGG + Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1125317246 15:38443993-38444015 AAATATCACCATATACTTATAGG - Intergenic
1126813536 15:52432610-52432632 AAATTTCACACCAACCCTATGGG - Intronic
1130263093 15:82374990-82375012 TAAGTTCACCACATCCCTTTAGG + Intergenic
1130701523 15:86187586-86187608 CAATCTCACCACAGCTCCATAGG - Intronic
1132278927 15:100595782-100595804 AAATCTGACCACAGCCCAAGAGG + Intronic
1134138531 16:11696818-11696840 AAATCCAACCACAACCCTCTGGG + Intronic
1134374366 16:13657690-13657712 ACTTCTCACTACATCCCTATAGG + Intergenic
1135078207 16:19412058-19412080 AAATCCCACAAAAACCCTATAGG - Intronic
1135742286 16:24986212-24986234 AATTCTCACATCAACCCTATTGG + Intronic
1140830806 16:78748950-78748972 AAATTTCACCACGGCCCTACGGG - Intronic
1141323843 16:83037230-83037252 AATTCTCACAACCTCCCTGTGGG + Intronic
1145233451 17:21191751-21191773 AACTCTCACCACATCCCTGTAGG + Exonic
1145749096 17:27342445-27342467 TAATCTCACCACAATCCTCTGGG + Intergenic
1145884136 17:28371239-28371261 AAACCTCACAACATGCCTATGGG - Intronic
1152263533 17:79280033-79280055 GAATGTCACCACACCCCTATGGG + Intronic
1155582768 18:27329339-27329361 TAATCTCACAACAACCCTAAGGG - Intergenic
1156984597 18:43334444-43334466 AAATATCACTATATGCCTATTGG - Intergenic
1157385371 18:47255503-47255525 AATTCTCACGACACCCCTGTGGG - Intergenic
1157450737 18:47786121-47786143 AAATCTAACAGTATCCCTATAGG - Intergenic
1158244474 18:55415529-55415551 AAGTCTCACCAAATCTGTATGGG + Intronic
1160617428 18:80142295-80142317 AAATCTCACAATAACCCTATAGG + Intronic
1161523120 19:4736824-4736846 AGCTCTCCCCACATTCCTATAGG + Intergenic
1164300858 19:23961927-23961949 AAATCTCACCACACTACTTTTGG + Intergenic
1164917878 19:32066358-32066380 GATTCTCAGCACATACCTATTGG + Intergenic
1165038066 19:33049030-33049052 AAACCTGACCACATATCTATGGG - Intronic
925600455 2:5603730-5603752 GAATTTCACCATATTCCTATGGG - Intergenic
925874665 2:8301634-8301656 AAATCTCAGCACAGCCCGACTGG - Intergenic
926579845 2:14623010-14623032 ATCTCTTACCACATCCCTTTCGG + Intergenic
926947794 2:18206890-18206912 AGATACCATCACATCCCTATTGG - Intronic
928493932 2:31812718-31812740 ACTCCTCACCACATCTCTATTGG + Intergenic
929898751 2:45983676-45983698 AAACCTCACCACCACCCTACAGG - Intronic
931865111 2:66401204-66401226 AAATCTCACCAAATTCTTACAGG + Intergenic
934558384 2:95299492-95299514 AATTCTCACCTCACTCCTATGGG + Intronic
937818031 2:126275278-126275300 AAACCTTACAACATGCCTATGGG - Intergenic
938224508 2:129604424-129604446 AAATCCCACCCCATCCCTGCAGG + Intergenic
938422143 2:131154392-131154414 AAATCTCACAACATCCCACTAGG - Intronic
939399688 2:141675567-141675589 AAACCTTACAAAATCCCTATAGG - Intronic
939457516 2:142456633-142456655 AAATACCACTACATACCTATTGG - Intergenic
940088329 2:149886896-149886918 AATTCTCATCACATCTATATTGG + Intergenic
940990993 2:160096360-160096382 AGAGCTCACAACAACCCTATGGG - Intergenic
945264893 2:207881423-207881445 AATCCTCACCACATCATTATGGG + Intronic
945431345 2:209769760-209769782 AATCCTCACAACATCTCTATAGG + Intergenic
947758515 2:232586833-232586855 AAATCTCACAAGAGCCCTGTGGG + Intergenic
1169527534 20:6446182-6446204 AATCCTCACAACATCCCTACAGG - Intergenic
1174195772 20:48771787-48771809 AATCCTCACCACAGCCCTGTGGG + Intronic
1177548842 21:22594999-22595021 TAATCACACCTCTTCCCTATAGG - Intergenic
1177622392 21:23613019-23613041 AAATCTCAGCAGACCCCTAAAGG - Intergenic
1178960746 21:37062402-37062424 AAATTTAACCACATCCACATAGG - Intronic
1180372595 22:12056440-12056462 TAATTTCACCAGATCCCTGTGGG + Intergenic
1182644134 22:31793980-31794002 AAATATCACAGCATCCCTGTGGG + Intronic
1184752695 22:46497772-46497794 TATTCTCACCAGATTCCTATGGG + Intronic
950570496 3:13796842-13796864 AATTCTAACCACAGCGCTATAGG - Intergenic
955340394 3:58120934-58120956 AATTTTCACCACAATCCTATGGG - Intronic
955523162 3:59794721-59794743 AAATCTCACCAAATCCTTTGAGG + Intronic
956827476 3:73011848-73011870 AAATCTTACCACACCAATATTGG + Intronic
956959954 3:74387708-74387730 ATATCTCATCACCTCCCTATGGG + Intronic
958612233 3:96441309-96441331 AAATCTCAGCACAACACTTTAGG + Intergenic
959476208 3:106815179-106815201 AACCCTCACTACAACCCTATAGG + Intergenic
960210592 3:114960564-114960586 AATACTCAACACATCCCCATAGG - Intronic
960811567 3:121631965-121631987 AAAGCTCATCACTTCCCTCTGGG + Exonic
962688176 3:137867301-137867323 AAATCTCAGCCTATCTCTATCGG - Intergenic
962932127 3:140048537-140048559 AGACCTCACAACAGCCCTATTGG + Intronic
963302075 3:143609978-143610000 AAATCTAAACAAATACCTATGGG - Intronic
963669008 3:148228788-148228810 AATTCTCAAAACATCTCTATAGG + Intergenic
963956888 3:151263840-151263862 CACTCTTACCACAACCCTATGGG - Intronic
963969165 3:151410269-151410291 TACTCTCACCCCATCCCTCTGGG + Intronic
964818586 3:160744258-160744280 AAAACACACCACACACCTATTGG - Intergenic
965495710 3:169396393-169396415 AAATTACAGCACATCCCAATTGG - Intronic
966552244 3:181217994-181218016 AATTCTCACATCAACCCTATAGG + Intergenic
968710693 4:2114733-2114755 AAATCTCACCAAATCCCAAATGG - Intronic
970015289 4:11506030-11506052 AAATCTCACAATAGCCCCATGGG - Intergenic
970557905 4:17254097-17254119 CAATCTCACCACAACCCAAAAGG + Intergenic
970587033 4:17523991-17524013 AAATCTCACCACATCCCTATGGG + Intronic
974205924 4:58703437-58703459 AAATTTCAGAAAATCCCTATGGG + Intergenic
977706317 4:100075066-100075088 AAATCTCATCACCTGCCTTTGGG + Intergenic
978435297 4:108677531-108677553 AATTATCAGAACATCCCTATGGG - Intergenic
978497567 4:109376640-109376662 TAATCTCACTGCATTCCTATCGG + Intergenic
978855665 4:113391458-113391480 AAATTTCACCAAATGCCTCTTGG - Intergenic
979303422 4:119113948-119113970 AATCCTCACAACAACCCTATGGG + Intergenic
980073068 4:128264080-128264102 TAAGCTCACTACATCCCTTTAGG - Intergenic
980683741 4:136198891-136198913 AAATCTCACAACAACCCTGTGGG + Intergenic
981544388 4:145879267-145879289 AACCTTCACCACAGCCCTATAGG - Intronic
985673001 5:1215923-1215945 AGATCTCACCACACCCCTGCTGG - Intronic
985874135 5:2582450-2582472 AAATCTGATCACATCCCTGTTGG - Intergenic
987426881 5:17783235-17783257 AATTCTTACCACATCACTAATGG + Intergenic
992167359 5:74067788-74067810 AAATTTCACAACATCAATATCGG - Intergenic
993507192 5:88723802-88723824 AAATCACACTACATCCTTCTTGG - Intronic
994830338 5:104774007-104774029 AAATCTCAACACATTTCTTTAGG - Intergenic
995936056 5:117515994-117516016 AAATGTCACCACATTACCATAGG - Intergenic
997720849 5:136077478-136077500 ATATCCCCCCACATCCCTCTAGG + Intergenic
997810622 5:136964327-136964349 AAGTCTCACCACAGTTCTATAGG - Intergenic
998107570 5:139478018-139478040 AATTCTCACCACCACCCTATGGG - Intronic
998706952 5:144772910-144772932 AAATCTCACCACAGCTACATAGG - Intergenic
999353504 5:150901722-150901744 AATTCTCACAACAACCCTATGGG + Intronic
1000392813 5:160743091-160743113 AATCTTCACCACAACCCTATGGG + Intronic
1001001989 5:168016147-168016169 AACCCTCACAACAACCCTATGGG + Intronic
1001548540 5:172585953-172585975 CAATCTCATCACTTCCCTATAGG + Intergenic
1001570563 5:172727833-172727855 CAATCTCACAACAAACCTATGGG + Intergenic
1002058674 5:176613200-176613222 AACTCTGACCACATCCCTTTGGG - Intergenic
1004299622 6:14445407-14445429 AAACCTAACCACGTCCCTCTGGG - Intergenic
1008256015 6:49300705-49300727 AAATCTCACAATAACCCTACAGG - Intergenic
1008943093 6:57068848-57068870 AAATCTCTCCACATCCTTGCCGG - Intergenic
1009571732 6:65393692-65393714 AAATCTCACCACATCAGTCATGG - Intronic
1010064764 6:71669249-71669271 AAACCTCAGCTCATCCCAATAGG - Intergenic
1010104649 6:72152286-72152308 AACTCTTACAACATACCTATGGG + Intronic
1010317829 6:74471013-74471035 TAAGCTCACCGCATCCCTTTAGG - Intergenic
1012848402 6:104418549-104418571 AAAGCTTACCTCATCCCTATTGG - Intergenic
1013236817 6:108204135-108204157 AATTCTCAAAACAACCCTATTGG - Intergenic
1016222583 6:141693102-141693124 AGATAGCACCACATGCCTATTGG + Intergenic
1018304287 6:162438671-162438693 AAATATCACACCTTCCCTATAGG - Intronic
1019834880 7:3373071-3373093 AAAACACACTACATCCGTATAGG - Intronic
1020205999 7:6116717-6116739 GAATCTCACCACCTACCTAGGGG + Intronic
1020805669 7:12787441-12787463 AGATATCACCACACACCTATCGG + Intergenic
1021863791 7:24934117-24934139 AAATCTCACCACTTCAATACAGG + Intronic
1022804543 7:33808551-33808573 AAGTCTCACTAGATCCCCATAGG - Intergenic
1025010837 7:55396613-55396635 ACCTCCCACCACATCCCTAAGGG + Intronic
1027988024 7:85320143-85320165 AAACCTCAAAACATCCTTATGGG - Intergenic
1028673157 7:93428244-93428266 AATCCTCACAACAGCCCTATGGG + Intronic
1028944972 7:96569154-96569176 TAATATCATCACATCCTTATTGG - Intronic
1028966173 7:96803991-96804013 AAATCTTAGAACATCCATATAGG + Intergenic
1030297157 7:107940606-107940628 AACTCTCACAATAACCCTATGGG + Intronic
1031456827 7:121991161-121991183 AAACCTCACCACAACCCTATAGG - Intronic
1032242391 7:130173790-130173812 AAATCTCAACACATTCTTTTAGG + Intronic
1033419999 7:141197201-141197223 AATTCTCACAATATCCCTAAGGG + Intronic
1037713885 8:21380025-21380047 AAAACTCATCACATCCAAATAGG - Intergenic
1038479849 8:27894388-27894410 CCATCTCACAACAGCCCTATGGG + Intronic
1039072791 8:33661541-33661563 AAATCTCACCAAACTCCTACAGG - Intergenic
1039186471 8:34922999-34923021 AAATCAAACTACATCCCTGTGGG - Intergenic
1039533423 8:38285834-38285856 AAATCTAACCACTTCCCTCCTGG + Intronic
1042385770 8:68172582-68172604 AAACATCACCACATCCCCAATGG - Intronic
1046102122 8:109627413-109627435 AATTCTTACCACATACCTTTCGG + Intronic
1046369871 8:113288864-113288886 AAATCTCCCAACATAACTATGGG - Intronic
1047187413 8:122646369-122646391 AAATCTCATCCCAATCCTATGGG + Intergenic
1047314665 8:123721817-123721839 AATTCTCCCAACAACCCTATGGG + Intronic
1047506900 8:125487252-125487274 AATTTTCACAACAGCCCTATGGG - Intergenic
1047624233 8:126639591-126639613 AAACCACTCCACATCCCTAGAGG - Intergenic
1048016171 8:130499629-130499651 AACTCTCACTACATCCCCAGAGG + Intergenic
1048784431 8:138035352-138035374 AATTCTCACAACAGCCCTCTGGG - Intergenic
1049129283 8:140822646-140822668 AACAACCACCACATCCCTATGGG + Intronic
1050256510 9:3797615-3797637 AAACTTCACAACATCCCTACGGG + Intergenic
1051587049 9:18737511-18737533 AACTCTCATCACTTCCCAATAGG + Intronic
1055532089 9:77194452-77194474 AAAGCTCACCACACACCTCTAGG - Intronic
1056785489 9:89589809-89589831 AATTTTCACAACAGCCCTATGGG - Intergenic
1057937899 9:99256336-99256358 CAATATCACCACATCCCTGGAGG - Intergenic
1058434337 9:104948413-104948435 AATTCTTACCACAGACCTATGGG - Intergenic
1058647776 9:107146455-107146477 AAGTCTTACCACATGCCTAGAGG + Intergenic
1187104718 X:16229462-16229484 AAAACTCACAACAACCCAATAGG - Intergenic
1187241277 X:17515745-17515767 AATTCTCACAACAACCCTATGGG + Intronic
1188147389 X:26630463-26630485 AAGTCTCACCATACTCCTATAGG - Intergenic
1190460087 X:50664119-50664141 AATTCTTACCAGATCCCTGTCGG + Intronic
1193702908 X:84785440-84785462 AAATCTCTGAACATCCCTTTGGG + Intergenic
1193744850 X:85264844-85264866 AACCCTCACAACAGCCCTATAGG - Intronic
1197272431 X:124439875-124439897 AATTCTCACAACCTCCCTATGGG + Intronic
1197360149 X:125491643-125491665 AAATCTCTTCACTTCTCTATGGG - Intergenic
1199597141 X:149515135-149515157 AACTCTCACTGCCTCCCTATTGG + Intronic
1200303581 X:155002969-155002991 CCATCTCACCACATCACTATGGG + Intronic
1201914161 Y:19164777-19164799 AGATCTCACCACTACCCTCTAGG + Intergenic