ID: 970587193

View in Genome Browser
Species Human (GRCh38)
Location 4:17526026-17526048
Sequence CAAAACATAGGGAAGTAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 241}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970587188_970587193 2 Left 970587188 4:17526001-17526023 CCTCCCAGAAAGTCAAAGTTTCA 0: 1
1: 0
2: 0
3: 15
4: 198
Right 970587193 4:17526026-17526048 CAAAACATAGGGAAGTAGTTTGG 0: 1
1: 0
2: 0
3: 14
4: 241
970587189_970587193 -1 Left 970587189 4:17526004-17526026 CCCAGAAAGTCAAAGTTTCAAGC 0: 1
1: 0
2: 2
3: 19
4: 214
Right 970587193 4:17526026-17526048 CAAAACATAGGGAAGTAGTTTGG 0: 1
1: 0
2: 0
3: 14
4: 241
970587190_970587193 -2 Left 970587190 4:17526005-17526027 CCAGAAAGTCAAAGTTTCAAGCA 0: 1
1: 0
2: 3
3: 21
4: 227
Right 970587193 4:17526026-17526048 CAAAACATAGGGAAGTAGTTTGG 0: 1
1: 0
2: 0
3: 14
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970587193 Original CRISPR CAAAACATAGGGAAGTAGTT TGG Intronic
900074603 1:802980-803002 CAAAATAAAGATAAGTAGTTTGG - Intergenic
901554407 1:10020128-10020150 CAAAAAATAGAAAATTAGTTGGG + Intergenic
903903346 1:26665089-26665111 GAAAACATAGGCAAGCAGATAGG - Intergenic
905085505 1:35372362-35372384 TAAACCATGAGGAAGTAGTTGGG + Intronic
905328346 1:37174432-37174454 CAAAATATTGGGAGGCAGTTAGG - Intergenic
905497821 1:38408326-38408348 CAAAACAAAGATAAATAGTTGGG + Intergenic
907721137 1:56973459-56973481 CAAAAAAAAGAGAAGAAGTTTGG - Intergenic
908616013 1:65923519-65923541 CAAAACATTGGTAAGTATCTGGG - Intronic
909157340 1:72094629-72094651 CAAAACATAGGACAGTGGTAGGG - Intronic
909975068 1:82036400-82036422 CAAAACAAAGGCATGTAGGTTGG - Intergenic
911122439 1:94309853-94309875 CAAAACAAAGGGATGTTCTTTGG + Intergenic
915653051 1:157333637-157333659 CAAGCCTTTGGGAAGTAGTTAGG + Intergenic
916318566 1:163478139-163478161 CAAAACATAAGAAAGAATTTAGG - Intergenic
916354780 1:163892507-163892529 CAAAACTTAGGGAAGTATGGCGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916917910 1:169429815-169429837 AAAAACAAAGGTAAGTAGATGGG - Intronic
918216154 1:182392896-182392918 CACAACATAGGTAGGTAGGTAGG + Intergenic
918829110 1:189368977-189368999 TTAAAGATTGGGAAGTAGTTTGG - Intergenic
919996487 1:202756183-202756205 CACAACATAGTGACATAGTTAGG + Intronic
920747070 1:208638940-208638962 AAAAACAGATGGAAGTAGTGAGG + Intergenic
922270450 1:224027886-224027908 CAAAATAAAGATAAGTAGTTTGG - Intergenic
923056924 1:230433493-230433515 AAAAAAAAAAGGAAGTAGTTGGG + Intergenic
923779868 1:237012566-237012588 GAAAAAAGAGGGAGGTAGTTTGG - Intergenic
1064069681 10:12217100-12217122 AAAAACACTGGGAAGTACTTAGG + Intronic
1067053387 10:43037882-43037904 GAAAACCAAGGGAATTAGTTGGG - Intergenic
1068733439 10:60385731-60385753 CAACAGATAGGTAAGTAGGTAGG - Intronic
1069092596 10:64219656-64219678 CAAAACCCAGTGAGGTAGTTAGG + Intergenic
1070208721 10:74292122-74292144 CACAACAGAGGTAAGTAGGTAGG - Intronic
1071500787 10:86202897-86202919 CAAGAAAGAGGGAGGTAGTTTGG - Intronic
1071796865 10:89017156-89017178 GAACACATAGGAAAGTAGTAGGG - Intergenic
1072421881 10:95296313-95296335 CAAAAAATACGAAAGTAGCTGGG + Intergenic
1072906994 10:99463497-99463519 CCTATCATAGGGAAGGAGTTGGG - Intergenic
1074344281 10:112667043-112667065 AAAAATATAGAGCAGTAGTTAGG - Intronic
1074942147 10:118246358-118246380 CAAAAAATAATGAAGTAATTAGG - Intergenic
1076251323 10:128986021-128986043 CAAAGCATAGGAAAGATGTTTGG + Intergenic
1077022394 11:423666-423688 CAAAAAATAGAAAATTAGTTGGG - Intronic
1078021029 11:7655987-7656009 CATATCATGGGGAAGCAGTTTGG + Intronic
1079608422 11:22399522-22399544 CAAGAGATAGTGAAGTACTTCGG + Intergenic
1079920123 11:26423003-26423025 GAAAACATAGGGCAGTAGGAAGG + Intronic
1083467231 11:62856489-62856511 CAGGACATAGGGAACCAGTTAGG - Intronic
1086262842 11:84961305-84961327 AATAACATAGGGAGGTAGTGGGG - Intronic
1087206586 11:95402633-95402655 CAAAACAAAGGTAAATAGATGGG - Intergenic
1090123974 11:124066382-124066404 CAGAACTTAGGGATGGAGTTAGG - Intergenic
1091789097 12:3261062-3261084 CAGAACACAGGGTAGGAGTTCGG - Intronic
1092580806 12:9838821-9838843 CAAAACATGGGTAAATAGTTTGG + Intronic
1092835423 12:12483590-12483612 CACAACATAGGGAGGTGATTAGG - Intronic
1093517829 12:20011532-20011554 CAAAACATTGGGAAGAAATGTGG + Intergenic
1094433626 12:30397688-30397710 GAAAACCTAGGAAAGTTGTTGGG - Intergenic
1097362608 12:58674556-58674578 CTAAACATAGAGAGGGAGTTGGG - Intronic
1097370659 12:58775898-58775920 CAAAACCTAAGTAAATAGTTTGG + Intronic
1098882251 12:75928481-75928503 CAAGAGATAGGGAAGGTGTTAGG - Intergenic
1098945326 12:76583172-76583194 CAAAAAGTAGGGAGGAAGTTAGG + Intergenic
1099276876 12:80587777-80587799 CCATACCTAGGGAAGTACTTAGG + Intronic
1099683871 12:85861306-85861328 CAAGATATAAGGAAGGAGTTTGG + Intergenic
1100093820 12:91006924-91006946 CTACACAAAGGCAAGTAGTTTGG - Intergenic
1101656327 12:106723695-106723717 CTAAGCATAGAGAAGCAGTTGGG - Intronic
1102081047 12:110098281-110098303 GAAAACATAGGGAGGCAGTCAGG - Intergenic
1103113173 12:118300701-118300723 CAAAGAATAAGGAAATAGTTAGG - Intronic
1105455567 13:20538205-20538227 CAAAACATAAAAAATTAGTTAGG + Intergenic
1106636645 13:31535779-31535801 CAAAACATAGGGATGCTTTTAGG - Intergenic
1107187353 13:37539249-37539271 GATAATATAGGGAAGTAATTAGG - Intergenic
1109469878 13:62790951-62790973 CAAAGTATAGGTGAGTAGTTTGG - Intergenic
1111949423 13:94698973-94698995 CAAAAAATAGAAAATTAGTTGGG - Intergenic
1112388568 13:98962199-98962221 AAAACTATAGGGAAGTAGTATGG + Intronic
1112973709 13:105291331-105291353 CAAACCTTAGGGAAGGAGCTAGG + Intergenic
1115917146 14:38328412-38328434 CAAAAGAAAGGGAATTAGTGTGG - Intergenic
1116215529 14:42012243-42012265 CAAAACAAAGGGTAGGAGTAAGG - Intergenic
1116707535 14:48321183-48321205 CAAAATTTAGGAAAGTAATTTGG - Intergenic
1117004596 14:51406720-51406742 AAATACATATGGAAGTAGTGAGG - Intergenic
1119973218 14:78996105-78996127 CAAAACATAGGGCAAAAGTTAGG - Intronic
1124806664 15:32890750-32890772 AAAAACAAAGATAAGTAGTTGGG - Intronic
1125441996 15:39712925-39712947 CAAAACATAGGGAAGATTTTAGG + Intronic
1127917994 15:63471186-63471208 AAAAAGATAGGTAGGTAGTTGGG + Intergenic
1132422365 15:101681883-101681905 CAAAACATATGATAGTACTTTGG - Intronic
1133476048 16:6123051-6123073 CATAACTTAGGGAGGTACTTAGG + Intronic
1140584102 16:76268173-76268195 CAGAAGATAGGGAAGCAGTGGGG + Intergenic
1141491379 16:84376153-84376175 CAACACAGAGATAAGTAGTTTGG + Intronic
1145353602 17:22114169-22114191 CAAAATATAGCGAAATACTTAGG + Intergenic
1145406907 17:22607789-22607811 CAAAAAATAGGAAAGTATTCTGG - Intergenic
1145966984 17:28926283-28926305 CACAACATAGGAAAGTTGCTTGG + Intronic
1146039643 17:29439056-29439078 CAATACATACTGAAGTATTTAGG - Intronic
1147204252 17:38825240-38825262 GAAAACGTAGAGAAATAGTTCGG + Exonic
1147925839 17:43945195-43945217 CTAGACATAGTGATGTAGTTAGG - Intergenic
1151014255 17:70535831-70535853 CAAAAAATAGTGATATAGTTTGG - Intergenic
1151130908 17:71895145-71895167 CACAACATAGGCCAGAAGTTGGG + Intergenic
1151592721 17:75056914-75056936 AGAAACAGAGGAAAGTAGTTAGG - Intronic
1153020825 18:627418-627440 CAAAACAGCTGGAAGAAGTTGGG - Exonic
1155813950 18:30279574-30279596 CAAAATATAGGAAACTAGTTTGG - Intergenic
1158138942 18:54236408-54236430 TAAAACATAGGAAAGCTGTTTGG - Intergenic
1158185519 18:54767063-54767085 AAACACATAGGGAAGAAGGTGGG + Intronic
1158445840 18:57519775-57519797 CAAAACATAGGGATGGAAATGGG - Intergenic
1158832001 18:61289826-61289848 CTAAACTTAGGGAAGTTATTGGG + Intergenic
1159092898 18:63869734-63869756 CAAGCCAAAGGGAAGGAGTTGGG + Intergenic
1159158279 18:64610774-64610796 TAAATGATAGGGAAGTAATTTGG + Intergenic
1161783094 19:6306662-6306684 CAAGACACAGGCAAGTTGTTGGG + Exonic
1162316807 19:9944189-9944211 AAAAAAAAAAGGAAGTAGTTGGG + Intergenic
1165679043 19:37757533-37757555 CAAAACAGAGCGAACTAATTGGG - Intronic
1166925042 19:46261337-46261359 CAAGACTTTGGGGAGTAGTTTGG + Intergenic
1168566491 19:57428813-57428835 AAATACATAGGAAAGTAGATAGG - Intronic
1168711660 19:58504351-58504373 AAAAAAATAGGGAAGTGGCTGGG + Intronic
925533823 2:4894454-4894476 CTAAAAATATGGAAGTAGCTGGG - Intergenic
925748263 2:7063487-7063509 CAAAGCTTAGGAAAGTAATTAGG + Intronic
926560592 2:14413146-14413168 AAAAACATAGATAAATAGTTAGG + Intergenic
926918273 2:17914341-17914363 CAGAACAAAGGGAAGTCTTTGGG + Intronic
929165493 2:38876967-38876989 CAAAATAGAGTGTAGTAGTTAGG - Intronic
929334784 2:40728539-40728561 AAGAAAATAGGGAAATAGTTGGG + Intergenic
934319272 2:91957832-91957854 CAAAAAATACAAAAGTAGTTGGG - Intergenic
938468890 2:131542508-131542530 GAAAAAATGGGAAAGTAGTTTGG - Intergenic
939349778 2:141020666-141020688 TAAAACAAAGAGAAGTATTTTGG - Intronic
940658011 2:156512189-156512211 CAAAACAGAGAAAATTAGTTTGG - Intronic
940701810 2:157054092-157054114 CAAAGCATAGGGAGGCAGATGGG - Intergenic
940889495 2:159021434-159021456 TTAAAAATAGGGAAGTAGCTGGG + Intronic
942230757 2:173859163-173859185 TAAATCATAGGGAAGTAACTAGG + Intergenic
943654153 2:190489637-190489659 CAAACCAGAGAAAAGTAGTTGGG - Intronic
946956697 2:224938380-224938402 CAAAAAATAGGTATTTAGTTTGG + Intronic
947348648 2:229220178-229220200 CAAAAAATAGGAAATTAGATGGG - Intronic
947913734 2:233818903-233818925 CAACACAGAGGGCAGCAGTTGGG - Intronic
948356944 2:237385609-237385631 CAAAACATAGGGAAATCTCTGGG + Intronic
1169621296 20:7509341-7509363 CAACACTTAGAGATGTAGTTTGG - Intergenic
1169970052 20:11260282-11260304 CAAAACATAGTAAAATAATTAGG - Intergenic
1171563862 20:26158352-26158374 CAAAATATAGCGAAATACTTAGG + Intergenic
1172256558 20:33523654-33523676 CAACACATAGGGAATAAATTAGG - Intronic
1174120578 20:48262243-48262265 CAAAACATACAAAATTAGTTGGG - Intergenic
1178944538 21:36935934-36935956 CAAAACATAAGAAAGGAATTGGG + Intronic
1182734092 22:32518473-32518495 CTAACCATAAGGAAGTAATTAGG + Intronic
1184207251 22:43013250-43013272 CATAACACAGAGAAGTAGATGGG - Intronic
949130836 3:498689-498711 TAAAACAGAGGGAGGTAATTAGG + Intergenic
950173867 3:10857926-10857948 GAAAACATAATGAAGTAGTCAGG + Intronic
950329503 3:12145373-12145395 CAAAACATAAAGAATTAGCTGGG + Intronic
950824925 3:15808437-15808459 CAAAGCAGAGGGAAGTTGATAGG - Intronic
951594017 3:24297691-24297713 TAAAACAGAGGGAAGGAGTTTGG - Intronic
952344164 3:32468545-32468567 CAAAAAATAGGGAAGGAGGGAGG - Intronic
954458529 3:50612758-50612780 CAAAACATAGGGAGATAATCTGG + Intronic
954851592 3:53605560-53605582 CAAAAATCAGGGAAGCAGTTAGG + Intronic
955538586 3:59950958-59950980 CAAACCATATGAAAGTGGTTAGG - Intronic
956389278 3:68754129-68754151 AAATACACAGTGAAGTAGTTAGG - Intronic
957627753 3:82676581-82676603 CATATCATAGGGAAGATGTTAGG - Intergenic
958018970 3:87974858-87974880 CAAAACTTAGGAAACAAGTTTGG + Intergenic
958064172 3:88521661-88521683 CAAAACAAAGATAAGTAGATGGG - Intergenic
959094870 3:101943888-101943910 CAAAAACTAGGGATGGAGTTTGG + Intergenic
959877381 3:111400745-111400767 CAAAACAGAGAGGAGTAGCTGGG + Intronic
961529742 3:127533243-127533265 AAAAAAATAGGGAAGTCTTTTGG - Intergenic
962416545 3:135187881-135187903 CAAAACAGAAGTAGGTAGTTGGG - Intronic
962626993 3:137235648-137235670 GAGAACATGGGGAAGGAGTTGGG + Intergenic
962867274 3:139458003-139458025 AAATACATACGGAAGTATTTAGG + Intronic
962884798 3:139614324-139614346 CAGAAAGTAGGGAAGTAGTCAGG - Intronic
963053849 3:141166648-141166670 CAAAACTTTGGAAAGCAGTTTGG - Intergenic
964188233 3:153972848-153972870 CAAAACAAAAGAAAGTAATTGGG - Intergenic
964766699 3:160186340-160186362 AAATAAATAGGGAAGGAGTTGGG + Intergenic
966162637 3:176984271-176984293 GAAATCATAGGGAAGTAAGTGGG - Intergenic
966562215 3:181335535-181335557 CAAAACATGAGGGAGTAGTTGGG - Intergenic
967021229 3:185524747-185524769 CAAAACATAAGGAAGAAATGGGG - Intronic
967741160 3:193003744-193003766 AAAAACAAAGATAAGTAGTTGGG - Intergenic
968669580 4:1841924-1841946 CAAAACGTCAGGAAGTAGGTGGG - Intronic
969437601 4:7197690-7197712 CAAACCATAGAAAAGAAGTTTGG + Intronic
970587193 4:17526026-17526048 CAAAACATAGGGAAGTAGTTTGG + Intronic
971987347 4:33844002-33844024 CAAAATATAGCGAAATACTTAGG - Intergenic
973818047 4:54636670-54636692 CAAAACATAAGGAATTGGATGGG - Intergenic
975836177 4:78424299-78424321 CAAAACAAAGGGCAGAGGTTAGG - Intronic
976579026 4:86712890-86712912 TAAAACATAGGGTAGTAGTAAGG + Intronic
977744829 4:100534586-100534608 TAAAACAAAGAGAAGTCGTTTGG + Intronic
978272689 4:106909562-106909584 AAGAACATGGGGAAGTGGTTGGG + Intergenic
979379779 4:119995119-119995141 AAAAACAGAGGGAAGGGGTTCGG - Intergenic
979409155 4:120353571-120353593 CAAAACGTATGTAAGTATTTGGG - Intergenic
979450728 4:120867615-120867637 CACAATAAAGGGAAGCAGTTGGG + Intronic
980585733 4:134813223-134813245 GAAAACATAGGAAAGCAGTTAGG + Intergenic
981784186 4:148459066-148459088 GAAAACAAAGGGTAGTAATTTGG + Intergenic
982161269 4:152572370-152572392 CAAAGAATAGGAAAGCAGTTGGG + Intergenic
987709200 5:21487209-21487231 CAAAACATACTGACATAGTTTGG - Intergenic
987904911 5:24063829-24063851 CAAAATATAGGGATATAGTTTGG + Intronic
987960939 5:24807674-24807696 CAAAACAAAAGGAAATAGCTGGG + Intergenic
988750411 5:34186943-34186965 CAAAACATACTGACATAGTTTGG + Intergenic
991180979 5:63750742-63750764 GTAAATATAGGGAAGTGGTTAGG + Intergenic
991429876 5:66533428-66533450 TAAAAGATAGTGTAGTAGTTTGG - Intergenic
991692383 5:69237501-69237523 CAAAGCATAGGGAAGGAGGGAGG - Intronic
991738671 5:69650142-69650164 CAAAACATACTGACATAGTTTGG + Intergenic
991759527 5:69906285-69906307 CAAAACATACTGACATAGTTTGG - Intergenic
991787809 5:70211833-70211855 CAAAACATACTGACATAGTTTGG + Intergenic
991790246 5:70229883-70229905 CAAAACATACTGACATAGTTTGG + Intergenic
991814995 5:70504974-70504996 CAAAACATACTGACATAGTTTGG + Intergenic
991818130 5:70526259-70526281 CAAAACATACTGACATAGTTTGG + Intergenic
991838756 5:70781351-70781373 CAAAACATACTGACATAGTTTGG - Intergenic
991880255 5:71212197-71212219 CAAAACATACTGACATAGTTTGG + Intergenic
991882695 5:71230223-71230245 CAAAACATACTGACATAGTTTGG + Intergenic
993204980 5:84867441-84867463 CAAAACAAAGGGAATGAATTTGG - Intergenic
994041817 5:95267592-95267614 AAAGAGATAGGGAAGTAGGTTGG - Intronic
994692641 5:103036781-103036803 CAATACATATGGAAGTATTTAGG - Intergenic
996013613 5:118507287-118507309 CAAAAGATAAGGAAGTGGGTTGG + Intergenic
996611613 5:125387564-125387586 CAAAACATTAAGAAGTAATTAGG + Intergenic
996627144 5:125584101-125584123 CATAACAAAAGGAGGTAGTTAGG + Intergenic
997773095 5:136572098-136572120 CAAAAAATAGTGAAATACTTAGG - Intergenic
1001804581 5:174572419-174572441 CCAAAGATAGGAAAGAAGTTTGG - Intergenic
1003232090 6:4263454-4263476 CAAAACAGACGGAAGAAGGTGGG - Intergenic
1009570957 6:65383651-65383673 CAAACTATAGGGAGGTAGATGGG - Intronic
1009933754 6:70207467-70207489 CAAAACATATGGAATGAATTTGG - Exonic
1011722636 6:90174953-90174975 CAAAATCCAGGAAAGTAGTTGGG + Intronic
1011764227 6:90602451-90602473 CAAAAAAAAGAGAACTAGTTAGG - Intergenic
1012629135 6:101441892-101441914 CAGAACATAAGAAAGTAGTCTGG + Intronic
1013730952 6:113166267-113166289 CAAAAGATAGTGAAGTGATTAGG - Intergenic
1014119511 6:117707334-117707356 ACAAAAATAGGGAAGTAGCTGGG - Exonic
1016528070 6:145025872-145025894 CAAAACACAGGAAAATACTTTGG + Intergenic
1020773010 7:12419610-12419632 CCAAACATAGAGAAAAAGTTGGG - Intergenic
1021367181 7:19794320-19794342 CAAAACTAAGGAAATTAGTTTGG - Intergenic
1024677315 7:51648383-51648405 CAGCACAGAGGGAAGTTGTTTGG + Intergenic
1024796049 7:53022013-53022035 CAAAACATATTGTAGGAGTTTGG + Intergenic
1025273866 7:57555936-57555958 CAAAATATAGCGAAATACTTAGG - Intergenic
1026267668 7:68809610-68809632 CCAAACATAGAGAGGAAGTTAGG + Intergenic
1027449290 7:78311490-78311512 CTAAAGAGAGGGAAGTAGTAGGG + Intronic
1029497832 7:100906990-100907012 CAAAACACAGGGCACTAGTCGGG - Intergenic
1030146018 7:106356827-106356849 CAAAAGATAGGAAAGGAGTCAGG - Intergenic
1030913530 7:115282906-115282928 CAAACAATAGGGCAATAGTTTGG + Intergenic
1032012906 7:128358705-128358727 CAAAACTTAGGGAAGCAGCTGGG + Exonic
1035541033 8:438506-438528 CAAAATAAAGTTAAGTAGTTTGG + Intronic
1038573672 8:28685472-28685494 TAAAACATAGGCTAGTTGTTTGG + Intronic
1039597066 8:38799512-38799534 CAAAAGATAGGGAATTTGTGAGG + Intronic
1040440127 8:47432803-47432825 CCATACAATGGGAAGTAGTTTGG + Intronic
1041593451 8:59618862-59618884 CAAATCAGAAGAAAGTAGTTTGG + Intergenic
1042650690 8:71037530-71037552 AAAATCAGAGGGAAGTAGTTGGG - Intergenic
1043049720 8:75370369-75370391 TAGAACACAGGGAAGAAGTTTGG + Intergenic
1043741659 8:83821233-83821255 GAAAAGATAGAGAAATAGTTGGG - Intergenic
1043875466 8:85481121-85481143 TAAAACATAGGAAAGTAGAATGG + Exonic
1043943597 8:86225021-86225043 CAAAAAATAGGGAAGCAGACTGG - Intronic
1044962029 8:97540824-97540846 CAAATGATGGGGAAGTATTTTGG - Intergenic
1045183007 8:99806390-99806412 GAAAACATTGGGAAGCAGCTGGG - Intronic
1046374528 8:113359349-113359371 AAAATCATAGGCAAGTAGGTGGG + Intronic
1046706814 8:117463310-117463332 CAAAACGTATGGAGGTAGTTGGG - Intergenic
1047271141 8:123360316-123360338 CAACAAAAAAGGAAGTAGTTAGG - Intronic
1047916196 8:129586589-129586611 CAAAGCATAGCGAAGAGGTTTGG + Intergenic
1050220091 9:3377730-3377752 CAAAGAAGAGGGAAGTATTTGGG + Intronic
1050226553 9:3463967-3463989 TAAAAAATAGGGAAATGGTTTGG + Intronic
1052276346 9:26680842-26680864 CAAAACAAAGCAAAGTAGCTGGG - Intergenic
1053222525 9:36324248-36324270 CAAAACATGGGGAACTGGCTGGG + Intergenic
1055507589 9:76964196-76964218 CAAAGGATGGGGAACTAGTTTGG + Intergenic
1057437840 9:95058697-95058719 CACAACAAAGGGTAGTAGTGAGG + Intronic
1057981923 9:99671358-99671380 AGAAACAAAGGGAAGGAGTTCGG - Intergenic
1059056352 9:110985174-110985196 CAAAACATAAGGTAGTCATTTGG - Intronic
1060988847 9:127836773-127836795 CTAAACATGTGGGAGTAGTTTGG + Intronic
1061096906 9:128463099-128463121 CAAAAAATAGAAAACTAGTTGGG + Intronic
1186036996 X:5434574-5434596 CACCACATAGGGAAGGAATTCGG + Intergenic
1186549823 X:10491873-10491895 CAAAAGATAGGAAAGTATATAGG - Intronic
1189755370 X:44266075-44266097 CAATAAATTGGGAAGTATTTGGG - Intronic
1190099599 X:47512261-47512283 ACAAAAATAGGGAAGTAGCTGGG + Intergenic
1190259630 X:48789862-48789884 CAACAGATAGGGATGAAGTTGGG + Intronic
1191068598 X:56377160-56377182 CAAAATATAGGGCAGAAGTTGGG - Intergenic
1191168568 X:57418311-57418333 CAAAACACTGGGCAGCAGTTTGG - Intronic
1192791439 X:74385672-74385694 CAAAAAATACTAAAGTAGTTGGG + Intergenic
1193472201 X:81920145-81920167 TGAAACAAAGGGAAGAAGTTAGG - Intergenic
1194316932 X:92388949-92388971 CAAAAAATAGGGAAATGGATTGG + Intronic
1195661774 X:107385823-107385845 CCAAACAGAGGGAAGGAGGTGGG + Intergenic
1196690242 X:118551238-118551260 TAAAACACAGGGAAGAAGCTTGG - Intronic
1198716458 X:139562777-139562799 CAGAACATAGGGATGAAGTAAGG + Exonic
1199893235 X:152109131-152109153 CAAAACAAAAGGAAGTGGCTAGG - Intergenic
1200496813 Y:3895425-3895447 AAAAACATTGGGGACTAGTTTGG - Intergenic
1200537188 Y:4413199-4413221 CAAATCATATGAAAGTTGTTAGG + Intergenic
1200625108 Y:5502269-5502291 CAAAAAATAGGGAAATGGATTGG + Intronic
1200786967 Y:7269411-7269433 CAAAAAATACGAAATTAGTTGGG - Intergenic