ID: 970589620

View in Genome Browser
Species Human (GRCh38)
Location 4:17547893-17547915
Sequence GTGCTAGGGCTGCCACAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970589620_970589626 8 Left 970589620 4:17547893-17547915 CCAGTCTGTGGCAGCCCTAGCAC No data
Right 970589626 4:17547924-17547946 AAGGGTACAATACGAAGTGGAGG No data
970589620_970589628 12 Left 970589620 4:17547893-17547915 CCAGTCTGTGGCAGCCCTAGCAC No data
Right 970589628 4:17547928-17547950 GTACAATACGAAGTGGAGGAGGG No data
970589620_970589622 -10 Left 970589620 4:17547893-17547915 CCAGTCTGTGGCAGCCCTAGCAC No data
Right 970589622 4:17547906-17547928 GCCCTAGCACTCTAATACAAGGG No data
970589620_970589627 11 Left 970589620 4:17547893-17547915 CCAGTCTGTGGCAGCCCTAGCAC No data
Right 970589627 4:17547927-17547949 GGTACAATACGAAGTGGAGGAGG No data
970589620_970589629 17 Left 970589620 4:17547893-17547915 CCAGTCTGTGGCAGCCCTAGCAC No data
Right 970589629 4:17547933-17547955 ATACGAAGTGGAGGAGGGTCAGG No data
970589620_970589625 5 Left 970589620 4:17547893-17547915 CCAGTCTGTGGCAGCCCTAGCAC No data
Right 970589625 4:17547921-17547943 TACAAGGGTACAATACGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970589620 Original CRISPR GTGCTAGGGCTGCCACAGAC TGG (reversed) Intergenic
No off target data available for this crispr