ID: 970589992

View in Genome Browser
Species Human (GRCh38)
Location 4:17551366-17551388
Sequence CTGCACTCCACCATGGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970589989_970589992 -9 Left 970589989 4:17551352-17551374 CCAAGATCACACCACTGCACTCC 0: 12852
1: 50033
2: 111758
3: 133101
4: 115174
Right 970589992 4:17551366-17551388 CTGCACTCCACCATGGTGACAGG No data
970589988_970589992 16 Left 970589988 4:17551327-17551349 CCAGAGAGTTGGAGGTTGCAGTG 0: 29
1: 2386
2: 41224
3: 115195
4: 211601
Right 970589992 4:17551366-17551388 CTGCACTCCACCATGGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970589992 Original CRISPR CTGCACTCCACCATGGTGAC AGG Intergenic
No off target data available for this crispr