ID: 970590848

View in Genome Browser
Species Human (GRCh38)
Location 4:17559609-17559631
Sequence ATGGTGGAGTAGACAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970590848_970590860 14 Left 970590848 4:17559609-17559631 CCCTCCCCTGTCTACTCCACCAT No data
Right 970590860 4:17559646-17559668 TTTGTCTTCACAGCCCAAGATGG No data
970590848_970590861 20 Left 970590848 4:17559609-17559631 CCCTCCCCTGTCTACTCCACCAT No data
Right 970590861 4:17559652-17559674 TTCACAGCCCAAGATGGCTCCGG No data
970590848_970590855 -10 Left 970590848 4:17559609-17559631 CCCTCCCCTGTCTACTCCACCAT No data
Right 970590855 4:17559622-17559644 ACTCCACCATCCCTAGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970590848 Original CRISPR ATGGTGGAGTAGACAGGGGA GGG (reversed) Intergenic
No off target data available for this crispr