ID: 970592345

View in Genome Browser
Species Human (GRCh38)
Location 4:17570405-17570427
Sequence CTGCAGATAGAGAGGAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970592345_970592350 12 Left 970592345 4:17570405-17570427 CCCCTTTTCCTCTCTATCTGCAG No data
Right 970592350 4:17570440-17570462 TAATAACTCCTATAACATGGTGG No data
970592345_970592349 9 Left 970592345 4:17570405-17570427 CCCCTTTTCCTCTCTATCTGCAG No data
Right 970592349 4:17570437-17570459 TCTTAATAACTCCTATAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970592345 Original CRISPR CTGCAGATAGAGAGGAAAAG GGG (reversed) Intergenic
No off target data available for this crispr