ID: 970593013

View in Genome Browser
Species Human (GRCh38)
Location 4:17576052-17576074
Sequence TTTTGGAGAGGGCTATAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970593013_970593023 16 Left 970593013 4:17576052-17576074 CCACACTATAGCCCTCTCCAAAA No data
Right 970593023 4:17576091-17576113 CCCCAAATTCCTCAGGGAGATGG No data
970593013_970593019 9 Left 970593013 4:17576052-17576074 CCACACTATAGCCCTCTCCAAAA No data
Right 970593019 4:17576084-17576106 ACCTTGACCCCAAATTCCTCAGG No data
970593013_970593021 10 Left 970593013 4:17576052-17576074 CCACACTATAGCCCTCTCCAAAA No data
Right 970593021 4:17576085-17576107 CCTTGACCCCAAATTCCTCAGGG No data
970593013_970593026 24 Left 970593013 4:17576052-17576074 CCACACTATAGCCCTCTCCAAAA No data
Right 970593026 4:17576099-17576121 TCCTCAGGGAGATGGATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970593013 Original CRISPR TTTTGGAGAGGGCTATAGTG TGG (reversed) Intergenic
No off target data available for this crispr