ID: 970593015

View in Genome Browser
Species Human (GRCh38)
Location 4:17576064-17576086
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 612
Summary {0: 17, 1: 51, 2: 82, 3: 85, 4: 377}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970593015_970593026 12 Left 970593015 4:17576064-17576086 CCTCTCCAAAACCCTTAAAAACC 0: 17
1: 51
2: 82
3: 85
4: 377
Right 970593026 4:17576099-17576121 TCCTCAGGGAGATGGATTTGAGG No data
970593015_970593023 4 Left 970593015 4:17576064-17576086 CCTCTCCAAAACCCTTAAAAACC 0: 17
1: 51
2: 82
3: 85
4: 377
Right 970593023 4:17576091-17576113 CCCCAAATTCCTCAGGGAGATGG No data
970593015_970593019 -3 Left 970593015 4:17576064-17576086 CCTCTCCAAAACCCTTAAAAACC 0: 17
1: 51
2: 82
3: 85
4: 377
Right 970593019 4:17576084-17576106 ACCTTGACCCCAAATTCCTCAGG No data
970593015_970593021 -2 Left 970593015 4:17576064-17576086 CCTCTCCAAAACCCTTAAAAACC 0: 17
1: 51
2: 82
3: 85
4: 377
Right 970593021 4:17576085-17576107 CCTTGACCCCAAATTCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970593015 Original CRISPR GGTTTTTAAGGGTTTTGGAG AGG (reversed) Intergenic
900428487 1:2591357-2591379 GGCATTTAAGGGTTTAGGAAGGG - Exonic
900486748 1:2926248-2926270 AGGTTTTTAGGGTCTTGGAGAGG + Intergenic
900762986 1:4485432-4485454 GGTATTTAAACGTTCTGGAGTGG + Intergenic
901427416 1:9191273-9191295 GGATTTTAAGGGGTTTGGAGTGG - Intergenic
901729348 1:11267599-11267621 GGTTTTTAAGGGGATTGTAGAGG + Intergenic
901861246 1:12076002-12076024 GGTATTTAAGGGTTCTGGGATGG - Intronic
902030229 1:13416739-13416761 GGCTTCTAATGGTTTTGGTGAGG + Intronic
902978470 1:20106689-20106711 GGTTTTTAAGGGTTTTGGAGTGG - Intergenic
904527012 1:31141346-31141368 GGTATTTAAAGGTTTTGGAGTGG + Intergenic
904943584 1:34182475-34182497 GGTTTGTAAGTGTGTGGGAGAGG + Intronic
905382294 1:37571574-37571596 GGGTTTTAAGGGTTTTGGAGTGG - Intronic
905990092 1:42329455-42329477 GTGTTTTCTGGGTTTTGGAGTGG + Intronic
906019521 1:42615110-42615132 GGTTTTTAAGGATTTTGGATTGG + Intronic
906395026 1:45455415-45455437 GTTTTTTAAGGGTTTTGAAGTGG - Intronic
906913540 1:49982714-49982736 GGTTTTTATGGGGTTCAGAGGGG - Intronic
907312815 1:53548946-53548968 GGTTTCTAGGGATTTGGGAGAGG - Intronic
907650045 1:56286314-56286336 GGACTTTAAGGGTCTTAGAGGGG - Intergenic
908168513 1:61482267-61482289 GGATTTTAAAGGTTTTGGAGTGG + Intergenic
908908821 1:69048434-69048456 TCTTGTTAAGAGTTTTGGAGAGG + Intergenic
909599650 1:77448308-77448330 GATTTTTATGGGCTTTGGAGGGG - Intronic
910259877 1:85284386-85284408 GGTTTTTATGGGCTTCAGAGGGG - Intergenic
910355016 1:86343310-86343332 GGTTTTAAAGGCTCATGGAGAGG - Intergenic
910863566 1:91766960-91766982 AGTTTTTAAGGGTTTTGGGTGGG - Intronic
912364092 1:109118684-109118706 TTTTTGTAAGGATTTTGGAGTGG + Intronic
912448465 1:109755218-109755240 GGTTTCCAAGGGTTGAGGAGTGG + Intronic
912911850 1:113769174-113769196 GGTTTTTAAAGGTTTTGGAATGG - Intronic
912914753 1:113803012-113803034 GGTTGCTAGGGGTTTTAGAGAGG - Intronic
912940485 1:114040332-114040354 GGATTTTGAGGGGTTTGGAGTGG + Intergenic
912954392 1:114144294-114144316 GATTTTTAAGGCATTTGGACAGG - Intronic
912984542 1:114414286-114414308 ATTTTTGAAGGGTTTTGGTGGGG - Intronic
913288576 1:117250838-117250860 GGTTTTTAAAGGTTTTAGAGTGG + Intergenic
913667279 1:121059990-121060012 GGTTTTTAAGGGGATTGTGGAGG + Intergenic
914018969 1:143847133-143847155 GGTTTTTAAGGGGATTGTGGAGG + Intergenic
914657520 1:149755340-149755362 GGTTTTTAAGGGGATTGTGGAGG + Intergenic
916921597 1:169474123-169474145 TATTTTTATGGGTTTTGGTGAGG + Intronic
916973146 1:170046098-170046120 AGTTTTTAAGGGTTTTGGACTGG - Intronic
917093729 1:171379805-171379827 GGTTTTTAAGGGTTTCAGAGTGG - Intergenic
917104413 1:171478085-171478107 GGTTTTTAAGGGTTTCAGAGTGG - Intergenic
917262876 1:173188884-173188906 TGTTTTTTGGGGTTTTTGAGGGG + Intronic
918009853 1:180576699-180576721 GGTTTTTAAGGGTTTTGGAGTGG - Intergenic
918486164 1:185030608-185030630 GGTTTATAGGGTTTATGGAGTGG + Intergenic
919414479 1:197290509-197290531 GGTTTTTAATGGTCATGGAAAGG - Intronic
919833416 1:201557545-201557567 GGTAGTTAAGTGTTTTGGGGAGG - Intergenic
920160491 1:203994215-203994237 AATTTTTAAGTGTTTTGTAGAGG + Intergenic
920170535 1:204069728-204069750 GGATTTTAAGGGGTTTGGAGTGG - Intergenic
920798152 1:209160654-209160676 GGATTTTAAGGGGTTTGCAATGG - Intergenic
921406154 1:214781572-214781594 AGTTTCTACGGGTTTTGGAGTGG + Intergenic
921407985 1:214801791-214801813 GGATCATATGGGTTTTGGAGTGG + Intergenic
921798453 1:219374888-219374910 GGTTTTAAAGAGTTTTGGAGTGG - Intergenic
922246407 1:223802697-223802719 GTTTTGTAATGGTTTTGGGGAGG - Intronic
922461758 1:225818749-225818771 GCTCTTTAAGGGTTTCGCAGGGG + Intronic
922876170 1:228941422-228941444 AGTTTTTAAAGGTTTTGAAGTGG - Intergenic
923133735 1:231099362-231099384 GGTTCTTATGGGTTTGGGATAGG + Intergenic
923271201 1:232356732-232356754 GGTTTTTACAAGTTTTCGAGTGG - Intergenic
923863272 1:237913940-237913962 GGTTTTTAAGGGTTTTGGAGTGG + Intergenic
924556685 1:245124854-245124876 GGTTTTTAAGGGTTTGGGAGTGG - Intronic
924722868 1:246639292-246639314 GGGTTTAAAGGCTTATGGAGAGG + Intronic
1062972718 10:1661081-1661103 GGTATTTAAGGGTTTAGGGAGGG - Intronic
1063162475 10:3429306-3429328 GGTTTTTAACGGTTTTGGAGTGG - Intergenic
1063236843 10:4126214-4126236 GATTTTTCAGGGTTTTGGAATGG - Intergenic
1063604525 10:7510610-7510632 GGTATTTAAGGGCTTTAGGGAGG + Intergenic
1063718547 10:8554924-8554946 GGTTTGTAAGCCATTTGGAGGGG + Intergenic
1064828788 10:19438125-19438147 GGTTTTTAAGGGTTGGGGGAGGG - Intronic
1064985552 10:21206692-21206714 GGTTTTCGAGAGTTTGGGAGTGG + Intergenic
1065006580 10:21386067-21386089 AGTTTTCAAGAGTTTTGGAGTGG + Intergenic
1065201448 10:23316847-23316869 GGTTTTTATGGGCTTCAGAGGGG + Exonic
1065207830 10:23374081-23374103 GGTTTTCAAGGGGTTTGGAGTGG - Intergenic
1065216900 10:23457878-23457900 AGTTTCTAAGGGTTTTGGAGTGG + Intergenic
1065734190 10:28736507-28736529 GGATTTTAATGGGTTTAGAGTGG + Intergenic
1065735232 10:28745393-28745415 GGTTTTTAAAGGTTTTGGAGTGG + Intergenic
1066242659 10:33553231-33553253 GGTTTTTAAGGGCTTTGGAGTGG - Intergenic
1066270995 10:33823473-33823495 GGTTTTTAAGGATTTTGGAGTGG - Intergenic
1066271446 10:33828209-33828231 GTTTTTAAAGGGTTTCGGAGTGG + Intergenic
1068023072 10:51608337-51608359 AGTTTTTATGGGTTTTGGAGTGG + Intronic
1068138392 10:52973827-52973849 GGTTTTTATGGGCTTAGAAGAGG + Intergenic
1068157693 10:53222794-53222816 GGTTTTTATGGGCTTCAGAGGGG + Intergenic
1068812228 10:61269117-61269139 GGCTTTTAAGGGTTTTGGAGTGG + Intergenic
1069022368 10:63503256-63503278 GTTTTTTAGGGGTTTTTGGGGGG + Intergenic
1069250625 10:66261906-66261928 GGTTTTTAAGGGTTTTGGAGTGG - Intronic
1069411913 10:68162821-68162843 GGTTTTTAAGGGTTTTGGAGTGG + Intronic
1069685500 10:70315768-70315790 AGTTTTTAACAGTTTGGGAGTGG - Intronic
1069697806 10:70399980-70400002 GCTTTTTTAGGGTTTTCTAGAGG + Intergenic
1069732194 10:70624352-70624374 AGATTTTAAGGAGTTTGGAGTGG + Intergenic
1069935286 10:71911566-71911588 GGTTCCTAAGGGTTTTGGAGTGG - Intergenic
1070122862 10:73595714-73595736 GGTTTTTAAAAGTCTTGGACTGG + Intronic
1070420938 10:76236567-76236589 GGTTTTTAAAGGTCTGGGAGCGG - Intronic
1070629327 10:78073544-78073566 GAGTTTTAAGGGTTTTGGAGTGG + Intergenic
1071371898 10:84959928-84959950 AGTTTTTAAGGGGTTTGGAGTGG - Intergenic
1071516841 10:86303668-86303690 AGTTATTAAGGGTTGTGGACAGG + Intronic
1072395496 10:95035711-95035733 AGTTTTTAAGGTTTTTGCTGAGG - Intergenic
1073895703 10:108154298-108154320 GTTTTCAAAGGGTTTTAGAGAGG + Intergenic
1075383218 10:122035760-122035782 GGTTATCAAGGGTTGGGGAGAGG - Intronic
1076811874 10:132890613-132890635 GGGTCTCGAGGGTTTTGGAGAGG - Intronic
1078346285 11:10552252-10552274 GGTTTTTAAGGGTTTCGGAGTGG + Intergenic
1078643498 11:13117223-13117245 GGTTTTTAAGAGTTTTGGAGTGG + Intergenic
1080219298 11:29881627-29881649 GGTTTTTAAGGGTGGTTTAGTGG - Intergenic
1081767380 11:45621116-45621138 GGTTTTTATGGGCTTCTGAGGGG + Intergenic
1082635110 11:55585051-55585073 GGGTTTAAAGGCTCTTGGAGAGG - Intergenic
1083351455 11:62032162-62032184 GTGTTTTAAGAGCTTTGGAGTGG + Intergenic
1083543706 11:63533494-63533516 GGGTTTTATGGGTGATGGAGAGG - Intergenic
1084632081 11:70359471-70359493 TTTTTTTATGGGTTTTGGAGAGG + Intronic
1084975867 11:72797938-72797960 AGTTTTACAGGGTTTGGGAGGGG - Intergenic
1085484766 11:76852850-76852872 GATTTTTAATTGTTTTGTAGAGG + Intergenic
1085540420 11:77262744-77262766 AGTTTTTAATGGTTTTGGAGTGG - Intronic
1086092766 11:83020704-83020726 GGCTTTTATGGGTCTTAGAGGGG - Intronic
1086223396 11:84477531-84477553 TTTTCTTAATGGTTTTGGAGAGG - Intronic
1086877365 11:92112555-92112577 GTTTGTGAAGGGTCTTGGAGAGG + Intergenic
1087048762 11:93866224-93866246 GGTTTTAAAGGCTCATGGAGAGG + Intergenic
1087453416 11:98353325-98353347 GGTTTTTTTGGGTTTCAGAGGGG + Intergenic
1087551401 11:99654975-99654997 AGTTTATAAGGGTTTTGGAATGG + Intronic
1088330344 11:108644502-108644524 AGTTTTTAAGGGTTTTGGAGTGG + Intergenic
1088682056 11:112251935-112251957 GGTTTTAAAGGGATTGGGGGTGG - Intronic
1089589398 11:119530965-119530987 GGTTTTGAATGGTTTTGGAGGGG - Intergenic
1089661377 11:119988044-119988066 GGATTTTAGGAGTTTTGGAGTGG + Intergenic
1090165034 11:124537576-124537598 GGTTTATGAGGGTTGTGGGGAGG - Intergenic
1090372374 11:126265599-126265621 AGATTTTAAGGGTTATTGAGAGG - Intronic
1090609567 11:128458193-128458215 TGTTTATAAGTGCTTTGGAGGGG - Intergenic
1091312826 11:134586661-134586683 GGTTCTTAAGGGTTTGGAAGTGG - Intergenic
1092024421 12:5228827-5228849 GGATTTTAAGGATTTTGGAGTGG + Intergenic
1092272275 12:7032670-7032692 GGTTTTTAAGGGGATTGTGGAGG + Intronic
1092632584 12:10398602-10398624 GGTTTATAAAGATTTTGGGGGGG - Intronic
1093306177 12:17523381-17523403 CATTTTTAAGGGGTTTGGGGTGG - Intergenic
1093425252 12:19021479-19021501 GGTTGTTAAGGATTTTGGAGTGG + Intergenic
1093764960 12:22952504-22952526 GGTTTTTATGGGCTTCAGAGGGG + Intergenic
1094412570 12:30182710-30182732 GGTTTTTATGGGTATAGGATGGG - Intergenic
1094800668 12:34030500-34030522 TGTTTTTAAGAGTTATTGAGTGG + Intergenic
1095676747 12:44928432-44928454 GGTGTTTAAAGGTCTTGGTGTGG - Intergenic
1096452199 12:51752977-51752999 GATTTTCAAGGGATTTTGAGAGG + Intronic
1097451651 12:59744260-59744282 GGTTTTTATGGGTATGGGATGGG - Intronic
1097747052 12:63313752-63313774 GTTGCTTGAGGGTTTTGGAGAGG + Intergenic
1098313532 12:69170761-69170783 GGCTTTTAAGAGCTTTGGAGTGG + Intergenic
1098671630 12:73237196-73237218 GGTTTTTCAGCGTTTTGCTGAGG - Intergenic
1099020441 12:77396966-77396988 GGTTTTTAAGTCTCTTGTAGTGG + Intergenic
1099557599 12:84128961-84128983 GGTTTTTATGGGCTTCAGAGGGG - Intergenic
1100705264 12:97193966-97193988 AATTTTTAAGGGTTTTGGAGAGG + Intergenic
1101319994 12:103665155-103665177 GGTTTAGAATGGTTTTTGAGTGG + Intronic
1101701727 12:107180084-107180106 AGAGTTTAAGGGGTTTGGAGTGG - Intergenic
1101869098 12:108547571-108547593 GGTTTTTAGAGGTTTTGGACAGG - Intronic
1102016832 12:109653651-109653673 CGTTTTTAAGGGTTTTGGAGTGG + Intergenic
1102409330 12:112703760-112703782 GGTTTTTAAAGGTTTTGGGGTGG - Intronic
1102447281 12:113013223-113013245 GGTTTTTAAGGGTTTGGGAGTGG + Intergenic
1103147776 12:118610429-118610451 CATTTTTAAGGGTATTGGTGTGG + Intergenic
1103177570 12:118877901-118877923 GTTTTTTAAGGTTTCTGGAGTGG - Intergenic
1104296518 12:127519937-127519959 CGTTTTTGACTGTTTTGGAGTGG - Intergenic
1104548004 12:129729995-129730017 GGTTCTTAAGGGTTTGGGATAGG - Intronic
1105464180 13:20621902-20621924 GGTTGCTAAGGGTTTGGGAGAGG - Intronic
1105587290 13:21756917-21756939 GGTTTTTATGGGTTTTGAATGGG - Intergenic
1105704052 13:22958038-22958060 GAGTTTTAGGGGTTTTGGTGTGG + Intergenic
1106663469 13:31826825-31826847 GGTTTTTAAGGGTTTTGGGGTGG - Intergenic
1107115407 13:36741040-36741062 GGTTTTTCAGGGGCTTGGAGTGG - Intergenic
1107158835 13:37201476-37201498 GGTTTTTAAGAGTTTTGAAATGG + Intergenic
1107170990 13:37341751-37341773 GGGGTTTAAGGGCTTTAGAGGGG - Intergenic
1107330164 13:39291088-39291110 GGTTTTTAAGGGTTTTGGAGTGG - Intergenic
1107517708 13:41147637-41147659 GGTTCCTAAGGGTTTTGGAGTGG - Intergenic
1107765732 13:43732573-43732595 GGTTTTTCAGTGTTTAGCAGTGG - Intronic
1108253510 13:48589476-48589498 AGTTTTTAAGGGTTTTGGAGGGG + Intergenic
1108542420 13:51456406-51456428 GGTTTTTATGGGCTTCTGAGAGG + Intergenic
1108559406 13:51627929-51627951 GGTTTTTATGGGCTTCAGAGGGG + Intronic
1108587542 13:51883514-51883536 GGTTTTTATGGGCTTAGAAGGGG + Intergenic
1108737031 13:53294913-53294935 GGTTTTTAAGGGTTTTGGAGAGG + Intergenic
1109438916 13:62343639-62343661 GGTTTTTATGGGCTTCAGAGGGG - Intergenic
1109762198 13:66844993-66845015 GTTTTTTACGGGTTTCAGAGGGG + Intronic
1110082976 13:71341087-71341109 GGTCTTCAAGGCTATTGGAGTGG - Intergenic
1110409398 13:75187247-75187269 GATTTTTAAGGGTTTTGGAGTGG - Intergenic
1111858556 13:93671591-93671613 GGTTTTTAAGGGTTTTTTAGGGG + Intronic
1112020826 13:95369635-95369657 GGTTTTTAAGGGTTTTAGGGTGG + Intergenic
1112069067 13:95828017-95828039 GATTTTTAAGGGTTTTGGAGGGG - Intronic
1112086131 13:96034082-96034104 GGTTTTTATGGGCTTCAGAGGGG - Intronic
1112246885 13:97743382-97743404 GGTTTGTAAGGGTTTGGGAGTGG + Intergenic
1113828144 13:113272962-113272984 GGATTTTAAGGGTTTCGGAGTGG - Intergenic
1113898180 13:113779017-113779039 GGTATTTAAGGATTTAGGAAGGG + Intronic
1114206313 14:20574663-20574685 GTTTTTTTATGGTTTTGGATGGG - Intergenic
1114958048 14:27848337-27848359 GGTTTTTAAGGGGATTGTGGCGG + Intergenic
1115485018 14:33901886-33901908 GGTTTTTATAGGCTTTAGAGGGG - Intergenic
1116221672 14:42095977-42095999 AATTTTTAAGGGTTTCAGAGGGG + Intergenic
1116338769 14:43695039-43695061 GGATTATAAGTGTTTAGGAGAGG - Intergenic
1118354630 14:65002738-65002760 GGCTTTTAAGGGTTTTGGAGTGG + Intronic
1119257173 14:73208638-73208660 GGTTTTTATGGGCTTCAGAGGGG + Intronic
1120208474 14:81611472-81611494 GGTCTTTAAGGGCTTTGGAGTGG + Intergenic
1120226034 14:81791846-81791868 GGTTTTTAAGAGTCTGGGAATGG - Intergenic
1120227386 14:81806562-81806584 GGATTTTATAGGTTTGGGAGAGG - Intergenic
1120551049 14:85873511-85873533 GATTTTCAAGGGCTTTGGAGGGG - Intergenic
1121596070 14:95163698-95163720 GGTTTTTTAGGGTTTTGGAGTGG - Intergenic
1121656144 14:95597247-95597269 AGTTTTTAAGGATTTAGGATGGG + Intergenic
1121737490 14:96228616-96228638 GGTTTTTATGGGTATAGGATGGG + Intronic
1122845763 14:104497371-104497393 GAGTTTTAGGGGTTTTGGTGTGG + Intronic
1124530018 15:30497820-30497842 GGTTTATAAGGGTTCAGGAGAGG - Intergenic
1124768641 15:32509868-32509890 GGTTTATAAGGGTTCAGGAGAGG + Intergenic
1125647036 15:41281296-41281318 TGTTTTTAAGGGATTAGCAGTGG - Exonic
1126129483 15:45326405-45326427 AGATTTTAAGGGTTTTGGAGTGG + Intergenic
1126215231 15:46146515-46146537 GGTTTTTATGGGCTTCAGAGGGG - Intergenic
1127058174 15:55153791-55153813 AGCTTTGAAGGGCTTTGGAGTGG - Intergenic
1127500300 15:59548565-59548587 GGTATTTAAGGGTTTAGGGAGGG - Intergenic
1127939175 15:63676432-63676454 GGTTCTTTGTGGTTTTGGAGTGG - Intronic
1128464594 15:67899493-67899515 AGTTTTTAAGGGTTTTGGAGTGG + Intergenic
1128497318 15:68205960-68205982 GGACTTTAAGGGTGGTGGAGGGG + Intronic
1130191520 15:81740914-81740936 ATTTTTTAATGTTTTTGGAGTGG + Intergenic
1130938059 15:88486808-88486830 GGTTTTTAAGAGTTTTGGAGTGG + Intergenic
1131018667 15:89079319-89079341 GGTTTTTCAGGACTTTAGAGAGG - Intergenic
1131120678 15:89821694-89821716 GTATTTTAATGGTTTTGTAGTGG - Intergenic
1131416639 15:92265575-92265597 GGTGATGGAGGGTTTTGGAGTGG + Intergenic
1131448824 15:92521818-92521840 GATTTTTAAGTGTTTTGGAGTGG + Intergenic
1131998261 15:98154420-98154442 GGTTTTTAAGGGTTTTGGAGTGG - Intergenic
1132740891 16:1412752-1412774 GGTTTTGAAGCGTTTTGTAGTGG - Intronic
1134855376 16:17514377-17514399 GGTTTTTAAGGGTTTTGGAGTGG + Intergenic
1135163534 16:20118275-20118297 AGTTTTTAAGGATTTTGAAGTGG - Intergenic
1135165989 16:20139537-20139559 GGGTTTTAAGGGTTTTGGAGTGG + Intergenic
1135385550 16:22036447-22036469 GGTTTTTAGGGTTTTTTTAGAGG + Intronic
1135396764 16:22137653-22137675 GGTTTTTAAGGGTTTTGCAGTGG + Intronic
1135635915 16:24075426-24075448 GATTTTTAAGGGTTTTGCAGTGG + Intronic
1135850516 16:25959102-25959124 GATTTTTAAGGGTTTTGGAGTGG + Intronic
1135899329 16:26442282-26442304 TGTTTTAATGGGTTTTGGATAGG - Intergenic
1137453317 16:48597687-48597709 GGCGTTTAAAGGTTTTGAAGTGG - Intronic
1137642068 16:50040756-50040778 GGTACTTCAGGATTTTGGAGTGG - Intergenic
1137758875 16:50924660-50924682 GGGTTTTAAGGATTTTGTAGTGG - Intergenic
1138075191 16:54035476-54035498 GGTCTTTAAGGTATTTTGAGGGG + Intronic
1138640048 16:58378329-58378351 GGATGTTAAGGGTTTTGGAATGG + Intronic
1138787467 16:59864397-59864419 AGTTTTTAAGGATTTTGGAGTGG - Intergenic
1139283003 16:65785805-65785827 GGTTTTTAAGGGTTTTGGAGTGG + Intergenic
1140335344 16:74099710-74099732 GGTTTTTAAGGTTTTTGGAGTGG - Intergenic
1141403190 16:83769086-83769108 GGTTTTTGAGGGCTTTGGAGTGG + Intronic
1143710699 17:8733176-8733198 GGTTCTTAAGGGTCTTAGACAGG - Intronic
1144553333 17:16260398-16260420 GGTTTTTATGGGCTTCAGAGGGG - Intronic
1145036586 17:19545015-19545037 GGTGTTTAAGGATTTTCGAATGG + Intronic
1146174231 17:30654702-30654724 GGTTTTTAAGGGGTATGGAGTGG + Intergenic
1146347686 17:32070729-32070751 GGTTTTTAAGGGGTATGGAGTGG + Intergenic
1146712646 17:35056011-35056033 GGTTTTTAAGGATTTTGGAGTGG - Intronic
1148188618 17:45662909-45662931 GTTTTTAAAGGATTTTGGAGTGG + Intergenic
1148517764 17:48237721-48237743 GGTTTTAAGGGATTTTGAAGAGG + Intronic
1153157475 18:2166112-2166134 GGATTTTAAGGATTTTGTAGTGG + Intergenic
1153427968 18:4987465-4987487 GGTTTTTATGGGATTCAGAGGGG + Intergenic
1153471379 18:5450163-5450185 GGTTGCTAAGGGTTTGGGGGTGG + Intronic
1153802651 18:8684797-8684819 GGGTTTTTAAGGGTTTGGAGTGG + Intergenic
1153802652 18:8684798-8684820 GGTTTTTAAGGGTTTGGAGTGGG + Intergenic
1153833739 18:8945790-8945812 GGTTTTTAAGGGTTTGGAGTGGG - Intergenic
1153833740 18:8945791-8945813 GGGTTTTTAAGGGTTTGGAGTGG - Intergenic
1156638832 18:39065193-39065215 GGTTTTGAGGGGTTTTAGAGTGG - Intergenic
1157023238 18:43812292-43812314 AGTTTTTAAGGATATTGGAGTGG - Intergenic
1157042885 18:44061058-44061080 GGTTTTTACGGGCTTCAGAGGGG + Intergenic
1157258349 18:46157830-46157852 GGTTCTTAAGGGTTTTGGAGTGG + Intergenic
1157506684 18:48231319-48231341 GGTTTTTATGGGCTTCAGAGGGG - Intronic
1157509039 18:48254721-48254743 GGTTTTTAAGGGCTTTGGAATGG - Intronic
1159189041 18:65017667-65017689 GGTTTTTATGGGCTTCAGAGGGG + Intergenic
1159675967 18:71284722-71284744 GGTTTTCATGGGTTTTGGCCAGG - Intergenic
1159726547 18:71967682-71967704 GGTTTTTATGGGTATAGGATGGG - Intergenic
1162880637 19:13656255-13656277 GGTTTTTAAGGGTGTTGGAGGGG + Intergenic
1162988178 19:14285324-14285346 GGTTTTTAAGGGGTATGGAGTGG - Intergenic
1163625086 19:18384649-18384671 AATTTTTAAGGATTTTGGAGTGG + Intronic
1164125733 19:22314995-22315017 GGTTTCTAAGGGTTGAGGACTGG - Exonic
1164684939 19:30160407-30160429 AGATTGTAAGGGTTTTGGAATGG - Intergenic
1165145883 19:33729777-33729799 GGTTTTTAAGGGTTTTGGAGTGG + Intronic
1166017734 19:39995672-39995694 CATTTTTAAGGGATTTGGGGGGG + Intronic
1166192858 19:41187067-41187089 GGTGTTCAAGGGTTTTGGAGTGG - Intergenic
1166441189 19:42816667-42816689 GGTTGTCAAGAGATTTGGAGAGG - Intronic
1166477961 19:43145247-43145269 GGTTGTCAAGAGATTTGGAGAGG - Intronic
1166548294 19:43647967-43647989 GATATTTAAGAGTTTTGGAAGGG + Intronic
1167058451 19:47128291-47128313 GCTTTTTAAGGGTTTTGGAGTGG + Intronic
1167468755 19:49663994-49664016 GGTTTCAAAGGCTTTTGAAGAGG - Intronic
1168219763 19:54952280-54952302 GGTTTTTAAGTGTTTTGGTGTGG - Intronic
925257996 2:2506433-2506455 GGTATTTAAGGGTTTAGGAAGGG + Intergenic
925527325 2:4817402-4817424 TGTTTTTTAGGATTTTGGACAGG + Intergenic
925826346 2:7851377-7851399 GGTTCTTTAGGATTTGGGAGAGG + Intergenic
926059946 2:9798974-9798996 AATTTTTAAGGGTTTTGAAGTGG + Intergenic
926113853 2:10198770-10198792 GGTATTTAAGGGTTTAGGGAGGG + Intronic
926554561 2:14341856-14341878 GGTTTTTATGGGCTTCAGAGAGG - Intergenic
926625458 2:15086156-15086178 GGCTTTTATGAGTCTTGGAGGGG - Intergenic
927891547 2:26753430-26753452 GGTTTTTAAGGGTTTTGGAGAGG + Intergenic
928314035 2:30232326-30232348 GGTTTTTAGGGGCGGTGGAGAGG - Intronic
929430233 2:41880115-41880137 GGCCTTTAAGTGTCTTGGAGGGG - Intergenic
929845400 2:45520594-45520616 GGTTTTTATGGGTTCAGGATAGG - Intronic
929940070 2:46326831-46326853 TGGTTCTAGGGGTTTTGGAGAGG + Intronic
930099548 2:47592231-47592253 GGTTTTTAAGGGTTTTGGAGTGG + Intergenic
930333209 2:50013057-50013079 GATATTTAAGGGATTTAGAGAGG - Intronic
930428019 2:51235431-51235453 AGATTACAAGGGTTTTGGAGTGG - Intergenic
930690116 2:54353505-54353527 GGTTTTCAAGGCTTCTGCAGAGG + Intronic
931372762 2:61679164-61679186 GAATTTTAAGGGCTTTTGAGTGG - Intergenic
931389795 2:61831774-61831796 GGTTTATAATGTTTTTTGAGAGG - Intronic
931448771 2:62350045-62350067 GGTTTTTAAGGATTTTGGAGTGG - Intergenic
931760516 2:65412785-65412807 GATTTTTAAGGGTTTTGGAGTGG - Intronic
932007870 2:67945684-67945706 GGTTTCTATGAGTTTTGTAGGGG + Intergenic
933167880 2:79095358-79095380 GGTTTTAAAGGCTCATGGAGAGG + Intergenic
933262690 2:80147880-80147902 GGTTTTAAAAGCTTTTAGAGCGG + Intronic
933263749 2:80158554-80158576 GGTTGTTAAGGGTTAAGGAGGGG - Intronic
933454931 2:82508260-82508282 GGTTTTTATGGGCTTCAGAGGGG - Intergenic
934108146 2:88715185-88715207 GGATTTTAAGGGTTTTGGAATGG + Intronic
934479253 2:94619707-94619729 GGTTTTTAAGGGGATTGTGGCGG - Intergenic
935240940 2:101177716-101177738 AGTTTTTAAGGGTTTTGGAGTGG + Intronic
935256142 2:101311291-101311313 GGTTCGTAAGAGTTTTGGAGTGG + Intergenic
935280880 2:101516809-101516831 TGTTTTTAAGGGTTTCAGAGTGG - Intergenic
937003899 2:118493648-118493670 GGTTTTTAAGAGTTTTGGAGTGG + Intergenic
937224925 2:120363278-120363300 CGTTTTTAAGGTTTCTGGGGTGG - Intergenic
937587409 2:123569597-123569619 GGTTATAATGGATTTTGGAGTGG - Intergenic
937757346 2:125556393-125556415 GGATTTTAAGGAATTTGGAAGGG + Intergenic
938729275 2:134133747-134133769 AGTTTTTAAGGGTTTTGGAAAGG + Intronic
939120823 2:138114222-138114244 GGTATTTAAGGGTATAGGAAGGG - Intergenic
939166748 2:138648748-138648770 GGGATTTAAGGGCTTTGGAGAGG + Intergenic
939259679 2:139791126-139791148 GGTTTACAAAGGTTATGGAGTGG + Intergenic
939496508 2:142933388-142933410 GATTTTTAAGGCTCATGGAGTGG + Intronic
939700633 2:145386656-145386678 GGTTTTTAAGGGTATAGGATGGG - Intergenic
939829860 2:147058643-147058665 GGTTTTTAAGGGTTTTGGAGTGG + Intergenic
939918997 2:148085422-148085444 TGCTTTTAAAAGTTTTGGAGCGG + Intronic
940424493 2:153515008-153515030 GGTTTTTAAGTGTTTTGGTTGGG + Intergenic
941958604 2:171230563-171230585 GGTGTTTAGGGGTTTTAGAGTGG - Intronic
941960073 2:171244714-171244736 AGTTTGTAAGGGGTTTGGAGTGG + Intergenic
942292797 2:174488188-174488210 GGTTCTTAAGGGTTTTAGAGTGG - Intergenic
942585047 2:177466308-177466330 GGTTTTTATGGGGTTCAGAGGGG + Intronic
942868039 2:180699555-180699577 GGTTTTTATGGGTTTCAGAAGGG + Intergenic
943043083 2:182825947-182825969 GGATTTTAAGGGATTTTCAGTGG - Intergenic
943832520 2:192480525-192480547 GGCTGTGAAGGGTTTTGGTGGGG + Intergenic
943950475 2:194128621-194128643 GGTTTTTATGGGCTTCAGAGTGG + Intergenic
943960229 2:194254554-194254576 GGTTTTTATGGGCTTTAGATGGG - Intergenic
944479096 2:200136751-200136773 GGTTTTTAAGAGTTTTGGAGTGG + Intergenic
944891102 2:204118019-204118041 GGTTTTTATGGGTATGGGATGGG + Intergenic
945742705 2:213682554-213682576 GGTATTTAAGCGTTTAGGAAGGG + Intronic
947938324 2:234026214-234026236 GGCTTTGATGGGTTTTGAAGGGG - Intergenic
948245220 2:236477002-236477024 GGTTTTTTAGTGTTTTGTTGAGG + Intronic
948382692 2:237561753-237561775 GGATTTTAAGGGTTTTTGGGGGG + Intergenic
1169011267 20:2252880-2252902 GATTTTTAAGGCTTTGGGTGTGG + Intergenic
1169319372 20:4618655-4618677 AGGTTTTTAGGGGTTTGGAGTGG + Intergenic
1169321053 20:4633617-4633639 GGATATTAAGGGCTTTGGAAAGG - Intergenic
1169632327 20:7647466-7647488 GGTTTTTATGGGCTTCAGAGAGG + Intergenic
1169743307 20:8918410-8918432 GGTTTCTAAGGGTTTGGGAGTGG - Intronic
1169909743 20:10637602-10637624 GGTTTTAAAGGGTTTGGAATTGG - Intergenic
1170156891 20:13277364-13277386 GGCTATTAAGGGTCTTGGAGGGG - Intronic
1170465547 20:16619386-16619408 AGGTTTTCAGGGGTTTGGAGTGG - Intergenic
1170530327 20:17284791-17284813 AGTTTTTAAGGGTTATGGAGTGG + Intronic
1170598528 20:17823363-17823385 GGTTTTCAGGGCTTTGGGAGAGG - Intergenic
1170958510 20:21003597-21003619 AGTTTATAAGGGTTCTGAAGAGG - Intergenic
1171172016 20:23023884-23023906 GGATGTTAACGGTTTTGGAGTGG - Intergenic
1173592919 20:44239486-44239508 GGATTTGAAGTGTTTTGGGGCGG + Intergenic
1173915426 20:46704721-46704743 GGATTTTAAGGGTTTTGGAGTGG + Intergenic
1174042337 20:47708909-47708931 GGTTTTTAAGGGTTGGGGGTTGG - Intronic
1174649181 20:52110308-52110330 GGTTTTCCAGGGTTTGGTAGGGG - Intronic
1175054438 20:56185427-56185449 GGTATCTGAGGGTTATGGAGTGG - Intergenic
1176071934 20:63231491-63231513 GGTTTTCCAGAGTTTTGGAGTGG + Intergenic
1176104616 20:63380107-63380129 GGTTTTTATGGGCTTCAGAGGGG - Intergenic
1177034238 21:16022096-16022118 GATTTCTAAGGGTTTGGAAGTGG + Intergenic
1177163672 21:17576104-17576126 AGTTTTTAAGGGCTTTGAAAAGG + Intronic
1177357817 21:20031603-20031625 GGTTTCTAAGGGCTTCAGAGGGG + Intergenic
1177624846 21:23646471-23646493 GGTTTTTATGTGTTTCAGAGGGG + Intergenic
1178721420 21:35013674-35013696 GATTTTTAAGAGTTTTGGTACGG - Intronic
1179024467 21:37668213-37668235 GGCCTCTATGGGTTTTGGAGAGG - Intronic
1180260654 21:46666801-46666823 AGTTTTTAAGTTTTTTGTAGAGG - Intergenic
1181592205 22:23892437-23892459 GATATTTAAGGGTTTTGGAGGGG + Intronic
1181595576 22:23912380-23912402 GATATTTAAGGGTTTTGGAAGGG - Intergenic
1182215000 22:28708605-28708627 CTTTTTTGAGGGATTTGGAGAGG + Intronic
1182273697 22:29171614-29171636 GGTCCTTGAGGGTTTTGGGGGGG + Intergenic
1182943102 22:34297027-34297049 GGTTTTTAAGGCTTTTGGGGAGG + Intergenic
1183283511 22:36947562-36947584 GGTTTTTAAGGGGATTATAGAGG - Intergenic
1184859919 22:47167691-47167713 GGTTTTTATGGGCTTTGAATGGG + Intronic
949358127 3:3203065-3203087 GGTCTTTAAGGGTTTTGGAGTGG - Intergenic
949789195 3:7774177-7774199 GTTTTTTAAGGCTATTGGAGAGG - Intergenic
950095577 3:10328430-10328452 GGTTTTTGGGGGTTGGGGAGGGG - Exonic
950391602 3:12701155-12701177 GGTTTCTAAGGGGTTTGGAGTGG + Intergenic
950749091 3:15114720-15114742 GGATTTTAAGGGGTTTGGAGTGG - Intergenic
950971226 3:17190383-17190405 GGTTTTCTAGTGTTTTTGAGGGG + Intronic
951873265 3:27390988-27391010 AATTTTTAAAGGTTTTGTAGAGG + Intronic
952540259 3:34359902-34359924 GTTTTTTAAGGATTTTGGAGTGG + Intergenic
957143090 3:76386507-76386529 CTTTTTTAAGGGTTTTTTAGGGG + Intronic
957310415 3:78511373-78511395 TGTTTTTAAGGGTTTTGGAATGG + Intergenic
957664287 3:83204187-83204209 GGTTATTAAGAATTTTGGGGTGG + Intergenic
958492295 3:94792696-94792718 GGTTTTCAACGGTTTTGAAGTGG - Intergenic
958584461 3:96068953-96068975 GGTTTTTATGGGCTTCAGAGAGG + Intergenic
959053726 3:101549147-101549169 AGATTTTAAGGGTTTTGCAGTGG + Intergenic
959195516 3:103175628-103175650 GGTGTTTAAGGGTTTTGGAGTGG + Intergenic
959614044 3:108327278-108327300 GGTTTTTAACATTTTTGGTGAGG + Intronic
960837264 3:121919464-121919486 GTTTTTTATGGGTTTTGAATGGG + Intronic
961078100 3:124000502-124000524 GGCTTTGGAGGGCTTTGGAGGGG + Intergenic
961525835 3:127496783-127496805 GGTTTTTACGGACTTTAGAGGGG - Intergenic
961595295 3:128011240-128011262 GGCTTTCAAGGGTTTTGGAGTGG + Intergenic
961942955 3:130656494-130656516 GGTTTTTATGGGTTTCAGAGGGG + Intronic
962921873 3:139957697-139957719 GGTTTGAAAGGGTTTCAGAGAGG + Intronic
963258645 3:143171302-143171324 GGTTTTTAGGGGTGTAGGAAAGG + Intergenic
963500690 3:146121688-146121710 GGTTTTTCAGGGAATTGCAGAGG + Intronic
963910540 3:150813863-150813885 AGTTTTTCAGGTTTTTGGGGGGG + Intergenic
964085240 3:152809320-152809342 AATTTTTTAGGTTTTTGGAGGGG - Intergenic
965314334 3:167172583-167172605 TGTTTTTAAGGGTTTTGGAATGG - Intergenic
965789930 3:172376415-172376437 GTTTTTAAAGGAGTTTGGAGAGG - Intronic
965872454 3:173278319-173278341 GGTTTTAAAGGCTCATGGAGAGG - Intergenic
965924288 3:173958558-173958580 GGTTTTTATGGGCTTCAGAGGGG + Intronic
966120055 3:176511051-176511073 GTTGCTTGAGGGTTTTGGAGAGG + Intergenic
966434711 3:179870409-179870431 GGTTTTTAAGGGTCTTGGAGTGG - Intronic
966457730 3:180136644-180136666 CAGTTTTAAGGATTTTGGAGTGG + Intergenic
966731275 3:183153355-183153377 GGCTTTTAAGTCTTCTGGAGTGG + Intronic
966953296 3:184845246-184845268 GGAATTTAAGTGTTTTGAAGAGG + Intronic
967519648 3:190414949-190414971 GGTTTTTATGGGCTTTGAATGGG + Intergenic
968475594 4:805311-805333 GGTTTTTCAGGGTTTGGGTTCGG - Intronic
969179246 4:5424472-5424494 GGTTTTTATGGGCTTCAGAGGGG - Intronic
970410320 4:15800129-15800151 AGTTTTTAAGGATTTAGGATAGG - Intronic
970593015 4:17576064-17576086 GGTTTTTAAGGGTTTTGGAGAGG - Intergenic
971482056 4:27123812-27123834 AGTTTTTAAGGGTTTTGGAGTGG - Intergenic
971616690 4:28799807-28799829 GGTATTTAAGGGTTTAGGGAGGG + Intergenic
972645848 4:40967030-40967052 GGTTTTTATGGGCTTCAGAGGGG - Intronic
972876818 4:43372558-43372580 GGTAGTGAGGGGTTTTGGAGAGG - Intergenic
973112659 4:46414481-46414503 GGTTTCTAAGGGTGTTGGAGTGG + Intronic
974228014 4:59073298-59073320 GGTTTTTAAAATTTTTCGAGGGG - Intergenic
974260272 4:59517848-59517870 GGTTTTTAAGGGCCTCAGAGGGG + Intergenic
974650739 4:64750669-64750691 AGTTTTTAAGGGTTTTAGAGTGG + Intergenic
974959015 4:68675685-68675707 GGTTTTAAAGGCTCATGGAGAGG - Intergenic
975221179 4:71814436-71814458 GGTTTTTATGGGTCTCAGAGGGG + Intergenic
975781770 4:77847934-77847956 GGATTTTAACGGTTTTGGAGTGG - Intergenic
976318721 4:83687053-83687075 GGTTTTAAAGGGTCTGGGTGAGG - Intergenic
976647363 4:87400043-87400065 GGTTTTTATGGGCTTCAGAGGGG - Intergenic
976866765 4:89737788-89737810 AGTTTTTAAAGGTTTGGCAGTGG + Intronic
976987334 4:91317996-91318018 GGGTTGTAGTGGTTTTGGAGAGG + Intronic
977984933 4:103372127-103372149 GGTTTTTAAGAGTTTCAGAGTGG + Intergenic
978325881 4:107553780-107553802 GGTTTTTAAGGGTGTGGGGATGG + Intergenic
979048268 4:115897162-115897184 CGTTTTTCAGTCTTTTGGAGAGG - Intergenic
979533153 4:121790583-121790605 GGTTTTTAAAGGTTTGAGAGTGG - Intergenic
980671159 4:136008758-136008780 GGTTTTTATGGTCTTTAGAGGGG - Intergenic
980978162 4:139630952-139630974 GGTTTTTAAGGGCTCTGTATGGG + Intergenic
981178739 4:141714343-141714365 GGGAATTAAGGATTTTGGAGGGG - Intronic
981751647 4:148098023-148098045 GGTTTTTAAGGGCTTGGGAGTGG - Intronic
983083570 4:163415841-163415863 GGATTTAAAAGGTTTTGGAGGGG + Intergenic
983640691 4:169941744-169941766 GGCTTTTTGGGGATTTGGAGTGG - Intergenic
984169428 4:176343197-176343219 GGGTTTTATGGGCTTTAGAGGGG + Intergenic
984905330 4:184621014-184621036 GGCTTTTAAGGGTTTTGGAGTGG - Intergenic
985197030 4:187442688-187442710 GAATTTTAAGGGTTTTGGCATGG - Intergenic
987046671 5:14115410-14115432 GATTTCTAAGGGTTTTGGAGTGG + Intergenic
987510199 5:18827528-18827550 TGTGTTAAAGGGTTTTGGGGTGG + Intergenic
987634119 5:20517654-20517676 GGTTTTTACGGGTTTTAGGAAGG + Intronic
988024145 5:25662906-25662928 GGTCTTTAAGGGTTTTGTCAAGG + Intergenic
988368116 5:30328865-30328887 AATTTTTTAGGGCTTTGGAGAGG - Intergenic
988565244 5:32315548-32315570 GGTATTTAAGGGTTTTGAAGTGG - Intergenic
988682028 5:33492994-33493016 GGTTTTTAAAGGTTTTAGAGTGG - Intergenic
988783653 5:34546096-34546118 AGCTTTAAAGAGTTTTGGAGTGG - Intergenic
988940401 5:36139591-36139613 GGTTTTTATGGGCTTCAGAGAGG - Intronic
990357255 5:54981476-54981498 TGTTTTTATGGATTTTGGAGAGG - Intronic
991171538 5:63632028-63632050 GGGGTTTAAGGCTTTTGTAGAGG - Intergenic
991293422 5:65056009-65056031 GGTTTGTTAGTGTTTTGGTGAGG + Intergenic
991561997 5:67963650-67963672 GAGTTTTAGGGGTTTTGGAGTGG + Intergenic
992331895 5:75725554-75725576 GGTTTTTAAAGGTCTTGGAGTGG + Intergenic
992872579 5:81021857-81021879 GGTTTTTAAAGGGTCTGGACAGG + Intronic
994891324 5:105639873-105639895 GGTTTTTATGGGTTTCAGAGGGG - Intergenic
994930218 5:106173176-106173198 GGTATTTAAGGGTTTAGGGAGGG - Intergenic
995724019 5:115166282-115166304 GGTTTTTATGGGCTTCAGAGGGG - Intronic
996062750 5:119050110-119050132 GAATTTTAAGGGTTTTAGATTGG - Intronic
997042795 5:130277835-130277857 GGTTTTTATGGGCTTCAGAGGGG + Intergenic
997154041 5:131532278-131532300 GTTTTAAAAGGGGTTTGGAGAGG - Intronic
997313999 5:132916575-132916597 GGCTTTTAAGGATTTTGGAGTGG - Intronic
998076292 5:139239447-139239469 GGTTTTTAAAGGTTTTGGAGTGG - Intronic
998328182 5:141300940-141300962 GGTTTTTCTTTGTTTTGGAGGGG + Intergenic
999496088 5:152099757-152099779 GGTTTTGCAGTGTTTTGGGGAGG - Intergenic
999872136 5:155763800-155763822 GTTTTTATAGGGTTTTGGTGGGG - Intergenic
1000117712 5:158169100-158169122 GGCTTTTAACCTTTTTGGAGAGG - Intergenic
1000233209 5:159334600-159334622 GGTTTTTAAGAGTTTGGGAGTGG - Intergenic
1001201268 5:169719307-169719329 CTTTTTGAAGGGCTTTGGAGAGG + Intronic
1001616636 5:173048154-173048176 GGTTTTTAAGGGTTTTGGAGTGG + Intergenic
1001837243 5:174842837-174842859 GAATTTTAAGGGGTTTGGAGTGG - Intergenic
1001914821 5:175550984-175551006 GGCATTTAAGGCTTTTTGAGAGG - Intergenic
1002003821 5:176215680-176215702 GGTTTTTAATTTTTTTGGAATGG - Intergenic
1002583923 5:180229319-180229341 GATTTTTAAGTGTTTTTTAGAGG - Intergenic
1002621319 5:180490560-180490582 GATTTTCAAGGGTTTTGGAGTGG - Intergenic
1002832781 6:838464-838486 GGATTTTAAGGAGTTTGGAATGG + Intergenic
1003949075 6:11101552-11101574 AGGGTTTAAGGGTTTTGGAGTGG + Intronic
1004289942 6:14357580-14357602 GGATTTTAAGGGTTTTGGAATGG + Intergenic
1004433039 6:15563745-15563767 GATTCTTAAAGGTTTTGGAGTGG - Intronic
1004433705 6:15569468-15569490 AGATTTTAAGGGGTTTGGAGTGG - Intronic
1004609319 6:17224317-17224339 TGTTTTCAAGGGTTTCGGAATGG + Intergenic
1004936004 6:20509068-20509090 GGTTTTTAATGTTTTTTGGGGGG - Intergenic
1005623111 6:27638202-27638224 GGATTTTAAGGGATTTGGAGTGG + Intergenic
1009587899 6:65629639-65629661 GGTTTTTAAAGGTTTTGGAGTGG - Intronic
1012540061 6:100352134-100352156 GGATTTTAAAGGATTTGCAGGGG + Intergenic
1012681315 6:102185072-102185094 GTTTTTTGAGGTTTTTGGTGTGG + Intergenic
1012866347 6:104622726-104622748 GGGTTTTTAGGATTGTGGAGTGG - Intergenic
1013335374 6:109153411-109153433 GATTTTTAAGTTTTTTGTAGAGG + Intronic
1013375908 6:109514018-109514040 GGTTTTTAAGAGTTTTGGAGTGG - Intronic
1014770491 6:125453529-125453551 GGTTTTTATGGGCTTCAGAGGGG - Intergenic
1015106707 6:129545187-129545209 GGGTTTTAAGGGGTCTGGATGGG - Intergenic
1015288514 6:131511250-131511272 GGTTTATATGGGTATTGGACAGG - Intergenic
1016119568 6:140329645-140329667 GTTGTTTGAGGGTTTTGGGGAGG + Intergenic
1016559313 6:145377593-145377615 GGTTTTTATGGACTTTGAAGTGG + Intergenic
1016956866 6:149635273-149635295 GGTTTTTGAGGGTTTTTTGGAGG - Intronic
1017049277 6:150375262-150375284 GATTTTTTAGAGTTTTGGGGTGG + Intronic
1017688422 6:156937358-156937380 GTTTTTTAGTGGTTTTGGAGAGG + Intronic
1018055636 6:160049954-160049976 GGGACTTAAGGGATTTGGAGCGG + Intronic
1019051661 6:169188307-169188329 GGTTTTGAAGGGTTTTGAGGAGG + Intergenic
1019760923 7:2812061-2812083 GTTTTTTCAGGTTTTTGGAGAGG - Intronic
1019760927 7:2812113-2812135 CGGTTTTAAGGTTTTTGGTGAGG - Intronic
1020402751 7:7796851-7796873 GGTTTTTAAGGGTTTTGGAGTGG - Intronic
1020418619 7:7973055-7973077 GGTTCTGAAGGGTATTGCAGTGG + Intronic
1020450376 7:8315024-8315046 GCTTGTGAAGGGTCTTGGAGAGG - Intergenic
1020586787 7:10079127-10079149 GGTTTTTATAGGCTTTAGAGGGG - Intergenic
1022091696 7:27111764-27111786 GGTTTTTCAGGTTCCTGGAGGGG - Intronic
1023347205 7:39283433-39283455 GGTTGTCAAGGGCTTGGGAGTGG - Intronic
1024449883 7:49527561-49527583 GGTTTTTAAGAGACTTGAAGAGG + Intergenic
1025023421 7:55497391-55497413 TGTTTTCACGGATTTTGGAGTGG - Intronic
1025159237 7:56639208-56639230 GGTTAGTAAGGGTTGAGGAGCGG + Intergenic
1025727319 7:64078686-64078708 GGCTTGTAAGGGTTGAGGAGCGG - Intronic
1026146951 7:67754720-67754742 GGTATTTAAGGGTTTAGGAAGGG + Intergenic
1026245503 7:68616007-68616029 TTTTTTTGAGGGTTTTGGAGTGG + Intergenic
1026245634 7:68617071-68617093 ACTTTTTAAGGGTTCTGGAATGG + Intergenic
1026527250 7:71165185-71165207 GGTTTTTCAGGGATTGGGAAGGG + Intronic
1026562628 7:71463057-71463079 GGGTTTTGAGGGTTCTGGAATGG + Intronic
1026604822 7:71806813-71806835 GGTTTTTAAGGGGATTGTGGAGG - Intronic
1026642181 7:72137087-72137109 TATATTTAAGGGTTTTGGAAAGG + Intronic
1027166542 7:75838535-75838557 GGTTTTTCAGAGTTTTGGAGTGG - Intergenic
1027194682 7:76021612-76021634 GGTTTTTAAGGGGATTGGGGAGG - Intronic
1027596940 7:80185545-80185567 CGTTTTTAGGGGTTTTGGAGTGG - Intronic
1027794275 7:82672779-82672801 AGTTTTTAATAGTTTTGGAAGGG - Intergenic
1028052261 7:86202758-86202780 GGTTTTTATGGGCTTCAGAGTGG + Intergenic
1028290277 7:89056929-89056951 GGGTTTTAAAGGTTTTGGAGTGG + Intronic
1029211372 7:98910932-98910954 GAATTTAAAAGGTTTTGGAGGGG + Intronic
1029589282 7:101496433-101496455 GGGGTTTGGGGGTTTTGGAGTGG + Intronic
1030484504 7:110149129-110149151 GGTTTTTATGGGCTTCAGAGAGG + Intergenic
1031192843 7:118576681-118576703 GGTTTTAAAGGGTTTTGCTATGG + Intergenic
1031206044 7:118758666-118758688 TCTTTTTATGGATTTTGGAGGGG - Intergenic
1031621207 7:123936274-123936296 GGTTTTTAAGGGGATTGTGGAGG + Intronic
1031837017 7:126690905-126690927 GGTTTTTATGGGCTTCAGAGGGG + Intronic
1031927675 7:127653322-127653344 GATTTGGAAGGGTTTTGGGGAGG - Intronic
1032246670 7:130219233-130219255 GGTTTTTCAGGATTATAGAGTGG - Intergenic
1032258091 7:130312783-130312805 GGTATTTAAGGGTTTAGGGAGGG + Intronic
1032277127 7:130467752-130467774 GGTTTTGAAGGGTTCTGGTCAGG + Intergenic
1032357017 7:131220571-131220593 GGTTATTAAGGGTTTTGGAGTGG + Intronic
1032591179 7:133193790-133193812 GGGTTTTATGGGTTTCGGAGTGG + Intergenic
1033342695 7:140504477-140504499 GGTTTTAATTGGTGTTGGAGTGG - Intergenic
1034746485 7:153528135-153528157 GGAATTTAAGGGTTTAGGAAGGG + Intergenic
1035436528 7:158863849-158863871 GGTGTTGGAGGGTGTTGGAGGGG + Intronic
1036192588 8:6684253-6684275 GGTTATTAGGGGCTGTGGAGAGG + Intergenic
1036509975 8:9391172-9391194 GGTTTTTAAGAGTTTTGGAGTGG + Intergenic
1036907643 8:12720494-12720516 GGTTTTTATGGGCTCAGGAGGGG - Intergenic
1036915430 8:12799625-12799647 GGTTTTTATGGTCTTTAGAGGGG + Intergenic
1037058556 8:14477288-14477310 GGTTTTAAAGGGTTTTGCTGTGG - Intronic
1038653216 8:29424757-29424779 GCTTTTTAAGGGTTTTGGAGTGG - Intergenic
1039182805 8:34885356-34885378 GGTTCTTAAGGGTTTTGGAATGG - Intergenic
1039271199 8:35882659-35882681 GGTTTTTAAGGATTTTGGAGTGG - Intergenic
1039891300 8:41687535-41687557 GGCTGTTAAGGGCTTTGGAGTGG - Intronic
1040371955 8:46785620-46785642 GGTTAATAAGGGTTGAGGAGCGG - Intergenic
1040380919 8:46871212-46871234 GGTTAATAAGGGTTGAGGAGTGG + Intergenic
1040680377 8:49801722-49801744 GGTTTTTAAGAGTTTTGGAATGG - Intergenic
1040821130 8:51558970-51558992 GGTTTTTAATGGATTAGTAGAGG + Intronic
1040856115 8:51949777-51949799 GGTTTTTAAGAGTGTTGGAATGG - Intergenic
1041164474 8:55077540-55077562 GGTTGTTAAGGATTTTGGAGTGG + Intergenic
1041319026 8:56594397-56594419 AGTTTTTAAGCTTTTTGGTGGGG + Intergenic
1041956178 8:63559745-63559767 GGTTTTTATGGGCTTCAGAGGGG + Intergenic
1043498919 8:80833874-80833896 GGTTTTTAGGGGTTTTGGAATGG + Intronic
1043961047 8:86418911-86418933 GTATTTTCAGTGTTTTGGAGAGG - Intronic
1043991636 8:86762738-86762760 ACTTTTTAAGGACTTTGGAGTGG + Intergenic
1044247665 8:89968259-89968281 GGTTTTTTGGGTTTTTGGTGGGG - Intronic
1044587272 8:93879422-93879444 AGTTTTGAAGGGTTTTGAAGTGG + Intronic
1045295218 8:100866593-100866615 AGTTTTTAAGGGTTTTGGAGTGG + Intergenic
1045415458 8:101962122-101962144 GATTATTATGGGTTTTTGAGTGG - Intronic
1046123997 8:109881614-109881636 ACATTTTAAGGGTTTTGGAGTGG + Intergenic
1047551143 8:125873470-125873492 GGTTTTTATTGGTGGTGGAGCGG + Intergenic
1047601624 8:126431525-126431547 GGTTTTTAAGAGTATTGAAATGG - Intergenic
1047612467 8:126534538-126534560 GGTTTTTAAGGGGATTGTGGAGG - Intergenic
1047827428 8:128592845-128592867 GGTTTTAAAATGTTTTGTAGAGG - Intergenic
1049826827 8:144674454-144674476 GGTTTTTATGGGCTTCAGAGGGG + Intergenic
1050214148 9:3303771-3303793 GTTTTTTAAGAGCTTTGGAAAGG + Intronic
1050633234 9:7582494-7582516 GGTTATTAAGGGTTTTGAAGTGG + Intergenic
1050937248 9:11413893-11413915 GGTTTTTATGGGCTTCAGAGGGG - Intergenic
1051608149 9:18936616-18936638 GGTTTTTCAGGGTCCTGTAGAGG - Intronic
1052223866 9:26060425-26060447 AGTTTTTCAGTTTTTTGGAGGGG + Intergenic
1052652368 9:31321260-31321282 GGCTTTTATGGGCCTTGGAGGGG + Intergenic
1053678576 9:40463858-40463880 GGTTTTTAAGGGGATTGTGGCGG + Intergenic
1053928561 9:43092212-43092234 GGTTTTTAAGGGGATTGTGGCGG + Intergenic
1054285148 9:63161084-63161106 GGTTTTTAAGGGGATTGTGGCGG - Intergenic
1054291654 9:63299396-63299418 GGTTTTTAAGGGGATTGTGGCGG + Intergenic
1054389670 9:64603939-64603961 GGTTTTTAAGGGGATTGTGGCGG + Intergenic
1054506042 9:65912437-65912459 GGTTTTTAAGGGGATTGTGGCGG - Intergenic
1055449255 9:76416119-76416141 GGTTTTTATGGGTATGGGATGGG - Intergenic
1055871481 9:80885979-80886001 GGATTTTAAGGGTTTTGGAGTGG - Intergenic
1056876110 9:90332446-90332468 GGATTTTAAGGATTTTGGAGTGG - Intergenic
1056902018 9:90608703-90608725 TGATTTTAAGGGTTTTGGAGTGG - Intergenic
1057358119 9:94348671-94348693 GGATTTTAAGGGGTCTGGACAGG + Intergenic
1057559903 9:96119232-96119254 GGATGTTAAGGGGTTTGGAGTGG - Intergenic
1057649630 9:96908946-96908968 GGATTTTAAGGGGTCTGGACAGG - Intronic
1059136891 9:111815736-111815758 TTTTTTTAAGGCTTTTGGAGTGG + Intergenic
1059773524 9:117451119-117451141 AGTTTATCAGGGTTTGGGAGTGG - Intergenic
1060382834 9:123192826-123192848 GGTTATTGAAGGTTTTGAAGAGG - Intronic
1061475937 9:130866415-130866437 ATTTTTCAAGGGTTTTGAAGAGG - Intronic
1185620132 X:1449119-1449141 GGTATTTAAGGGTTTAGGAAGGG - Intronic
1185676351 X:1852332-1852354 GGTATTTAAGGGTTTAGGAAGGG - Intergenic
1185946788 X:4385665-4385687 GGATTTTAAGGGTTTTAGAGTGG + Intergenic
1186223643 X:7375244-7375266 GGTTTTTATGGGCTTCAGAGGGG + Intergenic
1186230669 X:7450259-7450281 GGTTTATAAGGGTTTTGGAGTGG + Intergenic
1186280589 X:7988841-7988863 GGGCTTTAAGGGTTTTGGAGTGG - Intergenic
1186352853 X:8757527-8757549 GGGCTTTAAGGATTTTGGAGTGG + Intergenic
1186369099 X:8928379-8928401 GGTTTTGAAGAGTTTTTCAGTGG - Intergenic
1186762966 X:12742352-12742374 GGAATTTTAGGGTTTTGTAGTGG + Intergenic
1186943405 X:14538039-14538061 GGTTTTTCAGGGATTTGAAGTGG + Intronic
1186979246 X:14941254-14941276 GGGCTTTAAGGGTTTTGGAGTGG + Intergenic
1187734053 X:22286339-22286361 GGTGTTTAATGGTCCTGGAGGGG - Intergenic
1188417022 X:29947709-29947731 GGTTTTTAAATGATTTGCAGAGG - Intronic
1188882952 X:35513009-35513031 AGTTTGTAAGGATTTTGGAGTGG - Intergenic
1188970110 X:36605141-36605163 GGGTTATTAGAGTTTTGGAGTGG - Intergenic
1189368070 X:40404704-40404726 AATTCTTAAGGGTTTTGGAGTGG - Intergenic
1189962911 X:46341507-46341529 TGTTTTTAAGGGTTTTGGAGTGG + Intergenic
1190140408 X:47838072-47838094 AGTATTTAATTGTTTTGGAGTGG + Intronic
1191732688 X:64354162-64354184 GGTTGGTAAGGGTAGTGGAGTGG + Intronic
1191868968 X:65729380-65729402 AGGTTTTAAGGGTAATGGAGTGG - Intronic
1191921391 X:66260493-66260515 GGTTTTGAAGTAATTTGGAGAGG - Intronic
1192035709 X:67560670-67560692 GGGTTTTAAGAGTTTTGTAAGGG - Intronic
1192161157 X:68788858-68788880 GAATTTTAAGGGATTTGGAGTGG + Intergenic
1192291622 X:69802577-69802599 GGTTTTTGAAGGTATTGGATTGG + Intronic
1192945983 X:75966068-75966090 GGGTTTAAAGGCTCTTGGAGAGG + Intergenic
1193846580 X:86479240-86479262 GGTTTTTATGGGTATAGGATGGG + Intronic
1195277186 X:103293130-103293152 GGTAGCTAAGGGGTTTGGAGAGG + Intergenic
1195477069 X:105299414-105299436 GATTTTTAAGTGTCTCGGAGTGG + Intronic
1195527684 X:105910677-105910699 GGTTTTTAAGGGGATTGTAGAGG + Intronic
1196330160 X:114462696-114462718 GGTTATTAAGGCTCTTGTAGAGG + Intergenic
1196914020 X:120513410-120513432 GGTTTTAAAGGGTTTTGGAGTGG - Intergenic
1197035663 X:121870542-121870564 GGTTTTTATGGGTTTCACAGGGG - Intergenic
1198074892 X:133184872-133184894 GGGTTTTAAGAGTTTTGGAGTGG - Intergenic
1198759416 X:140016486-140016508 GGTTTTTATGGTTTTAGAAGGGG + Intergenic
1199211313 X:145214762-145214784 GGTTTTTATGGGTTTAGAATGGG + Intergenic
1199362248 X:146935500-146935522 GGATTTGAAGGGTATTGGACAGG - Intergenic
1199797067 X:151209574-151209596 GGTTTTTAAGGGTTTTACTATGG - Intergenic
1201733984 Y:17237257-17237279 GGTTTTTAAGAGTTTTAGAGTGG + Intergenic
1202268893 Y:23050824-23050846 GGTTAATAAGGGTTGAGGAGCGG - Intergenic
1202421885 Y:24684564-24684586 GGTTAATAAGGGTTGAGGAGCGG - Intergenic
1202448901 Y:24985514-24985536 GGTTAATAAGGGTTGAGGAGCGG + Intergenic