ID: 970593016

View in Genome Browser
Species Human (GRCh38)
Location 4:17576069-17576091
Sequence GTCAAGGTTTTTAAGGGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970593016_970593019 -8 Left 970593016 4:17576069-17576091 CCAAAACCCTTAAAAACCTTGAC No data
Right 970593019 4:17576084-17576106 ACCTTGACCCCAAATTCCTCAGG No data
970593016_970593028 30 Left 970593016 4:17576069-17576091 CCAAAACCCTTAAAAACCTTGAC No data
Right 970593028 4:17576122-17576144 TTTCCTCCCATCTCCTCCTTTGG No data
970593016_970593021 -7 Left 970593016 4:17576069-17576091 CCAAAACCCTTAAAAACCTTGAC No data
Right 970593021 4:17576085-17576107 CCTTGACCCCAAATTCCTCAGGG No data
970593016_970593026 7 Left 970593016 4:17576069-17576091 CCAAAACCCTTAAAAACCTTGAC No data
Right 970593026 4:17576099-17576121 TCCTCAGGGAGATGGATTTGAGG No data
970593016_970593023 -1 Left 970593016 4:17576069-17576091 CCAAAACCCTTAAAAACCTTGAC No data
Right 970593023 4:17576091-17576113 CCCCAAATTCCTCAGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970593016 Original CRISPR GTCAAGGTTTTTAAGGGTTT TGG (reversed) Intergenic
No off target data available for this crispr