ID: 970593023

View in Genome Browser
Species Human (GRCh38)
Location 4:17576091-17576113
Sequence CCCCAAATTCCTCAGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970593015_970593023 4 Left 970593015 4:17576064-17576086 CCTCTCCAAAACCCTTAAAAACC 0: 17
1: 51
2: 82
3: 85
4: 377
Right 970593023 4:17576091-17576113 CCCCAAATTCCTCAGGGAGATGG No data
970593013_970593023 16 Left 970593013 4:17576052-17576074 CCACACTATAGCCCTCTCCAAAA No data
Right 970593023 4:17576091-17576113 CCCCAAATTCCTCAGGGAGATGG No data
970593014_970593023 5 Left 970593014 4:17576063-17576085 CCCTCTCCAAAACCCTTAAAAAC No data
Right 970593023 4:17576091-17576113 CCCCAAATTCCTCAGGGAGATGG No data
970593017_970593023 -7 Left 970593017 4:17576075-17576097 CCCTTAAAAACCTTGACCCCAAA No data
Right 970593023 4:17576091-17576113 CCCCAAATTCCTCAGGGAGATGG No data
970593016_970593023 -1 Left 970593016 4:17576069-17576091 CCAAAACCCTTAAAAACCTTGAC No data
Right 970593023 4:17576091-17576113 CCCCAAATTCCTCAGGGAGATGG No data
970593018_970593023 -8 Left 970593018 4:17576076-17576098 CCTTAAAAACCTTGACCCCAAAT No data
Right 970593023 4:17576091-17576113 CCCCAAATTCCTCAGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970593023 Original CRISPR CCCCAAATTCCTCAGGGAGA TGG Intergenic
No off target data available for this crispr