ID: 970593026

View in Genome Browser
Species Human (GRCh38)
Location 4:17576099-17576121
Sequence TCCTCAGGGAGATGGATTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970593020_970593026 -9 Left 970593020 4:17576085-17576107 CCTTGACCCCAAATTCCTCAGGG No data
Right 970593026 4:17576099-17576121 TCCTCAGGGAGATGGATTTGAGG No data
970593014_970593026 13 Left 970593014 4:17576063-17576085 CCCTCTCCAAAACCCTTAAAAAC No data
Right 970593026 4:17576099-17576121 TCCTCAGGGAGATGGATTTGAGG No data
970593013_970593026 24 Left 970593013 4:17576052-17576074 CCACACTATAGCCCTCTCCAAAA No data
Right 970593026 4:17576099-17576121 TCCTCAGGGAGATGGATTTGAGG No data
970593015_970593026 12 Left 970593015 4:17576064-17576086 CCTCTCCAAAACCCTTAAAAACC 0: 17
1: 51
2: 82
3: 85
4: 377
Right 970593026 4:17576099-17576121 TCCTCAGGGAGATGGATTTGAGG No data
970593017_970593026 1 Left 970593017 4:17576075-17576097 CCCTTAAAAACCTTGACCCCAAA No data
Right 970593026 4:17576099-17576121 TCCTCAGGGAGATGGATTTGAGG No data
970593018_970593026 0 Left 970593018 4:17576076-17576098 CCTTAAAAACCTTGACCCCAAAT No data
Right 970593026 4:17576099-17576121 TCCTCAGGGAGATGGATTTGAGG No data
970593016_970593026 7 Left 970593016 4:17576069-17576091 CCAAAACCCTTAAAAACCTTGAC No data
Right 970593026 4:17576099-17576121 TCCTCAGGGAGATGGATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970593026 Original CRISPR TCCTCAGGGAGATGGATTTG AGG Intergenic
No off target data available for this crispr