ID: 970600267

View in Genome Browser
Species Human (GRCh38)
Location 4:17636557-17636579
Sequence CCTTCAGGCGGGTCTGCAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 191}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970600256_970600267 22 Left 970600256 4:17636512-17636534 CCCCTGACAGCCTCACCGTGAGC 0: 1
1: 0
2: 0
3: 12
4: 153
Right 970600267 4:17636557-17636579 CCTTCAGGCGGGTCTGCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 191
970600260_970600267 7 Left 970600260 4:17636527-17636549 CCGTGAGCTGCTTGATGATGTCC 0: 1
1: 0
2: 2
3: 16
4: 160
Right 970600267 4:17636557-17636579 CCTTCAGGCGGGTCTGCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 191
970600258_970600267 20 Left 970600258 4:17636514-17636536 CCTGACAGCCTCACCGTGAGCTG 0: 1
1: 0
2: 2
3: 15
4: 125
Right 970600267 4:17636557-17636579 CCTTCAGGCGGGTCTGCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 191
970600257_970600267 21 Left 970600257 4:17636513-17636535 CCCTGACAGCCTCACCGTGAGCT 0: 1
1: 0
2: 0
3: 16
4: 133
Right 970600267 4:17636557-17636579 CCTTCAGGCGGGTCTGCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 191
970600259_970600267 12 Left 970600259 4:17636522-17636544 CCTCACCGTGAGCTGCTTGATGA 0: 1
1: 0
2: 1
3: 6
4: 98
Right 970600267 4:17636557-17636579 CCTTCAGGCGGGTCTGCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 191
970600255_970600267 23 Left 970600255 4:17636511-17636533 CCCCCTGACAGCCTCACCGTGAG 0: 1
1: 0
2: 1
3: 13
4: 186
Right 970600267 4:17636557-17636579 CCTTCAGGCGGGTCTGCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970600267 Original CRISPR CCTTCAGGCGGGTCTGCAGG CGG Exonic