ID: 970600267

View in Genome Browser
Species Human (GRCh38)
Location 4:17636557-17636579
Sequence CCTTCAGGCGGGTCTGCAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 191}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970600255_970600267 23 Left 970600255 4:17636511-17636533 CCCCCTGACAGCCTCACCGTGAG 0: 1
1: 0
2: 1
3: 13
4: 186
Right 970600267 4:17636557-17636579 CCTTCAGGCGGGTCTGCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 191
970600260_970600267 7 Left 970600260 4:17636527-17636549 CCGTGAGCTGCTTGATGATGTCC 0: 1
1: 0
2: 2
3: 16
4: 160
Right 970600267 4:17636557-17636579 CCTTCAGGCGGGTCTGCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 191
970600256_970600267 22 Left 970600256 4:17636512-17636534 CCCCTGACAGCCTCACCGTGAGC 0: 1
1: 0
2: 0
3: 12
4: 153
Right 970600267 4:17636557-17636579 CCTTCAGGCGGGTCTGCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 191
970600258_970600267 20 Left 970600258 4:17636514-17636536 CCTGACAGCCTCACCGTGAGCTG 0: 1
1: 0
2: 2
3: 15
4: 125
Right 970600267 4:17636557-17636579 CCTTCAGGCGGGTCTGCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 191
970600259_970600267 12 Left 970600259 4:17636522-17636544 CCTCACCGTGAGCTGCTTGATGA 0: 1
1: 0
2: 1
3: 6
4: 98
Right 970600267 4:17636557-17636579 CCTTCAGGCGGGTCTGCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 191
970600257_970600267 21 Left 970600257 4:17636513-17636535 CCCTGACAGCCTCACCGTGAGCT 0: 1
1: 0
2: 0
3: 16
4: 133
Right 970600267 4:17636557-17636579 CCTTCAGGCGGGTCTGCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970600267 Original CRISPR CCTTCAGGCGGGTCTGCAGG CGG Exonic
900053280 1:610670-610692 CCAGCAGGCGGCGCTGCAGGAGG + Intergenic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900242429 1:1623464-1623486 CCCCCAGGCGGGCGTGCAGGTGG + Exonic
902706731 1:18210581-18210603 ACTTCAGGGGGGTATGCACGTGG - Intronic
903154418 1:21434429-21434451 CCTCCAGCTGGGTCTGCAGCAGG - Intergenic
903263376 1:22142973-22142995 CCTCCCGTCGGGGCTGCAGGTGG + Intronic
906537248 1:46558278-46558300 TCTGCAGGCGGGTGAGCAGGTGG + Exonic
907809936 1:57859011-57859033 CCATCAGGCACTTCTGCAGGGGG + Intronic
914350734 1:146837598-146837620 CCTTAATGGGGGTCTGCTGGTGG + Intergenic
921480895 1:215663574-215663596 CCTACAGGCAGGGCTGCATGAGG - Intronic
922695647 1:227729610-227729632 CCTTCGGCTGGGTCAGCAGGCGG + Intronic
1063207955 10:3853087-3853109 TCTTCACCCAGGTCTGCAGGAGG + Intergenic
1064190700 10:13203224-13203246 CCTGCAGACGGGGCTGCAGTAGG + Intronic
1069943585 10:71971399-71971421 CCTGCAGACTGGTCTGCAGACGG - Intronic
1070941780 10:80354756-80354778 CCCTCTGGCTGGTGTGCAGGTGG - Intronic
1071493333 10:86151719-86151741 CCCTCAGACAGGTCTGCAGAGGG - Intronic
1072881999 10:99236882-99236904 CCTCCAGGAGGGTCTGGAGGGGG - Intergenic
1073290025 10:102408903-102408925 TCTTCTTGCGGCTCTGCAGGCGG + Intronic
1073483610 10:103802656-103802678 CCTGCAGGGGTGTCTCCAGGAGG + Intronic
1075270579 10:121046309-121046331 CCCTCGGGTGGGTCTGCAGCAGG - Intergenic
1076164032 10:128267941-128267963 CCACCCGGCGGGTCTGCAGCAGG - Intergenic
1076757671 10:132581576-132581598 TCTTCTGGCGGGTGTGCAGTGGG + Intronic
1077011709 11:381672-381694 CCTGCAGGCAGGGCTGGAGGTGG + Exonic
1077083668 11:736543-736565 GCTTCAGGTGAGTCTTCAGGAGG + Intergenic
1077484355 11:2832024-2832046 CCTCCAGGCAGCCCTGCAGGTGG + Intronic
1081808048 11:45900670-45900692 CCTTGAGGCGGGATTGAAGGAGG + Intronic
1081808476 11:45902518-45902540 CCCCCAGGCGGGGCAGCAGGGGG - Exonic
1083746753 11:64741365-64741387 GCTTCAGGCTGGCCTGGAGGAGG - Intronic
1084064742 11:66697319-66697341 CCTTCAGGCCATTTTGCAGGTGG + Intronic
1084589263 11:70080643-70080665 CCTTCACCTGGGTTTGCAGGAGG - Intronic
1084757924 11:71251282-71251304 CCTCCAGGCGGGTCTGCGTGCGG - Intronic
1086405282 11:86494172-86494194 TCTTCAAGTGGGTCTGGAGGGGG + Intronic
1089597445 11:119589859-119589881 CTTTCATGGGAGTCTGCAGGAGG + Intergenic
1090940632 11:131385053-131385075 CCTCCAGGAGCATCTGCAGGGGG - Intronic
1091596555 12:1882625-1882647 ACCTCAGGCAGGTCTGCTGGGGG + Intronic
1091620572 12:2085195-2085217 CACTCAGGAGGGTCTGCAGTTGG - Intronic
1091804810 12:3348224-3348246 CCCTCAGCTGGGGCTGCAGGTGG + Intergenic
1094488247 12:30941773-30941795 CCCCCAGGCGGGACTGCAGCTGG - Intronic
1095817833 12:46443792-46443814 GCTGCAGGCTGGTCTGCAGAGGG + Intergenic
1095953713 12:47795213-47795235 GCTCCAGGCGGGGCTGCATGGGG + Exonic
1097495106 12:60322150-60322172 CCTTCTGGAGGCTCTGAAGGTGG - Intergenic
1098989021 12:77044269-77044291 CCTTCAGAAGAGTATGCAGGGGG + Intronic
1100543486 12:95579741-95579763 ACTTGAGGAGGGTCTGGAGGAGG + Intergenic
1104637420 12:130447001-130447023 TTTTCAGGGGGATCTGCAGGGGG + Intronic
1105684337 13:22763567-22763589 CTTTCACACGGGTTTGCAGGAGG + Intergenic
1105888778 13:24666791-24666813 CCCTCAGGCAGGTATGCAGTTGG - Intergenic
1113064437 13:106359046-106359068 CCTTGAGGTGGCCCTGCAGGTGG + Intergenic
1113914136 13:113860959-113860981 GCTTCAGGCAGGTGAGCAGGTGG + Intronic
1118197664 14:63642382-63642404 CCTTCAGGCCGGGCTGAATGTGG + Intergenic
1121232268 14:92366430-92366452 CAGCCAGGCGGGTTTGCAGGTGG + Intronic
1122112263 14:99510678-99510700 CCTCCAGGGGGGACGGCAGGAGG - Exonic
1122293152 14:100690280-100690302 CCTCCAGGAGGTGCTGCAGGTGG + Intergenic
1124625217 15:31303862-31303884 CTTGCAGGCAGCTCTGCAGGGGG - Intergenic
1125610513 15:40966278-40966300 CCCCCTGGCGGGTCAGCAGGCGG + Intergenic
1126440275 15:48680798-48680820 GCCTCAGGCGGATCTTCAGGAGG - Intergenic
1129257651 15:74343174-74343196 CCTGCAGGCGGGTGGGAAGGAGG + Intronic
1132558126 16:581445-581467 CTTTCAGTGGAGTCTGCAGGAGG + Intronic
1132727931 16:1346773-1346795 CCTCCAGGCCATTCTGCAGGTGG + Intronic
1132736456 16:1388394-1388416 CCTTCCCGCCTGTCTGCAGGAGG + Intronic
1132884147 16:2175161-2175183 CCTACAGGCGGGTGGGCAGGAGG + Intronic
1133633312 16:7642449-7642471 CCTTCAGAGGGGTCTGACGGTGG - Intronic
1133732679 16:8590138-8590160 CTTCCAGGAGGGTCTGAAGGCGG - Intergenic
1134517695 16:14900366-14900388 CCTTCTGCTGGGTCTGCAGATGG - Intronic
1134705364 16:16299017-16299039 CCTTCTGCTGGGTCTGCAGATGG - Intergenic
1134962177 16:18413097-18413119 CCTTCTGCTGGGTCTGCAGATGG + Intergenic
1134966474 16:18495696-18495718 CCTTCTGCTGGGTCTGCAGATGG + Intronic
1135510600 16:23079884-23079906 CCTTCAGACGGGTTTGCTTGTGG - Intronic
1136022124 16:27446938-27446960 CTTTCAGGCTGGGCTGCAGCAGG - Intronic
1139983301 16:70877946-70877968 CCTTAATGGGGGTCTGCTGGTGG - Intronic
1140823245 16:78682428-78682450 CCTTTAGCCGGGTCTGGTGGTGG + Intronic
1142123021 16:88396565-88396587 CCTTCAGGAGGGTCTCCATCTGG - Intergenic
1142140148 16:88469149-88469171 CCTGCAGGAGGGTCTGGAGTGGG - Intronic
1142215265 16:88826706-88826728 CCATCAGCCGGCCCTGCAGGAGG + Exonic
1142743563 17:1943737-1943759 GCTCCAGGCGGGGCTGCAGAGGG - Intronic
1143055457 17:4158776-4158798 CCTGCAGGCGGGTTAGGAGGAGG - Intronic
1143724360 17:8835308-8835330 CCTGCAGGCGGCTCTGGGGGAGG - Exonic
1144650057 17:17001824-17001846 CATTCAGGCTGGGGTGCAGGGGG - Intergenic
1144650200 17:17002451-17002473 CATTCAGGCTGGGGTGCAGGGGG - Intergenic
1146924842 17:36736997-36737019 CCTTCTGGAGGATCTGAAGGAGG - Intergenic
1147660780 17:42115800-42115822 CCTTCAGGTGGTTCATCAGGTGG + Exonic
1148911895 17:50947278-50947300 CCTCCTGGAGGGTCTGCAGGGGG + Intergenic
1151147845 17:72058014-72058036 TTTTCAGGAGGGGCTGCAGGGGG - Intergenic
1152589391 17:81203982-81204004 CCTTCCTGCGGGTCTGCGGAGGG - Intronic
1152803701 17:82344558-82344580 CCACCAGGAGGGTCTCCAGGAGG - Intergenic
1152947464 17:83205778-83205800 CCAGCAGGCGGCGCTGCAGGAGG - Intergenic
1152947498 17:83205914-83205936 CCAGCAGGCGGCGCTGCAGGAGG - Intergenic
1153332574 18:3889012-3889034 CCTTCAGGAGGTGCTGCAGCAGG + Intronic
1153900512 18:9614238-9614260 GCTTCAGGAGGACCTGCAGGAGG - Exonic
1154025531 18:10704342-10704364 GCTTCAGGCGGCTATGCAAGGGG - Intronic
1154083551 18:11280673-11280695 CCTTCAGGTGGATTTGCAGACGG + Intergenic
1157067198 18:44366265-44366287 GATACAGGCGGGTCTGGAGGGGG - Intergenic
1158570020 18:58590377-58590399 CCTTCAGCCAGGAATGCAGGGGG + Intronic
1160568619 18:79801673-79801695 CCTTCAGGCTGATCTGAATGTGG + Intergenic
1165874637 19:38997458-38997480 CCTTCATGGGGGTCTGGAGTGGG - Intronic
1166320970 19:42018739-42018761 CCCTCAGGTGTGGCTGCAGGAGG + Intronic
932699686 2:73984610-73984632 CCCTCCGGCGGGGCTGCAGCCGG - Intergenic
934470772 2:94531612-94531634 CCTTCAGGAGAATCTGCAAGTGG - Intergenic
936556013 2:113499418-113499440 GCTCCAGCCGGGGCTGCAGGTGG + Exonic
945037978 2:205720686-205720708 CCAGCTGGCGGGTCTTCAGGGGG - Intronic
948909575 2:240996361-240996383 TCTTCAGGCGGGTGGGCTGGTGG - Intergenic
1169145601 20:3250227-3250249 CCTCCAGGCGGCGCTCCAGGTGG - Exonic
1172280933 20:33707645-33707667 CCTTTGGGAGGGTCTGCATGGGG + Exonic
1176025360 20:62982815-62982837 GCTTCCGGAGGCTCTGCAGGAGG + Intergenic
1176762610 21:12971059-12971081 CCTTCAGGAGAATCTGCAAGTGG - Intergenic
1179113987 21:38472984-38473006 CCTCATGCCGGGTCTGCAGGCGG - Intronic
1179247151 21:39643825-39643847 CCTCGAGGCTGGTGTGCAGGGGG + Intronic
1180072597 21:45443772-45443794 CCTTTACGCGGCTCTGCTGGTGG + Intronic
1180174384 21:46080653-46080675 CCTGCAGGCTGGGCTGCAGTGGG - Intergenic
1180215000 21:46318205-46318227 CCCTCAGGCTGGTCTCCAGGAGG - Exonic
1180883837 22:19225525-19225547 CCTTCAGCTGTGTGTGCAGGTGG - Exonic
1181108819 22:20589843-20589865 CCCTCAGGCAGGTGTGCGGGTGG - Intergenic
1182898187 22:33875819-33875841 CCATCAGGTGGGGCTGCCGGAGG - Intronic
1184022898 22:41833050-41833072 CCTGGAGGCGGGGCCGCAGGGGG + Intergenic
1184606698 22:45578581-45578603 CCTTCAGGCCCCTGTGCAGGAGG + Intronic
1184732333 22:46377793-46377815 CCCTCAGGCGGGGCTGGAGGAGG - Intronic
1185064418 22:48623631-48623653 CCTGCAGACAGGTGTGCAGGAGG + Intronic
949514782 3:4797034-4797056 AACTCAGGCTGGTCTGCAGGAGG + Intronic
952350259 3:32528481-32528503 CCTGCAGGTGGGGCTGGAGGTGG - Exonic
953124438 3:40077867-40077889 GCTGCAGGTGGGGCTGCAGGTGG + Intronic
955341947 3:58131675-58131697 CCTTCATGGGGTTCAGCAGGAGG + Intronic
966549767 3:181192318-181192340 CATTCAGCCTGGTCTGGAGGTGG + Intergenic
968706026 4:2078147-2078169 TCTCAAGGCGGGTCTGCATGAGG - Intronic
968782200 4:2591476-2591498 CCTGAAGGCCGGTCGGCAGGAGG + Intronic
969591381 4:8123662-8123684 CCTTAAAGCGGGTCTCCTGGGGG + Intronic
970600267 4:17636557-17636579 CCTTCAGGCGGGTCTGCAGGCGG + Exonic
972841121 4:42931331-42931353 CATTCTGGTGGGTCTGCAGCAGG + Intronic
974260514 4:59518903-59518925 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260536 4:59518967-59518989 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260558 4:59519031-59519053 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260580 4:59519095-59519117 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260584 4:59519107-59519129 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260588 4:59519119-59519141 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260601 4:59519157-59519179 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260614 4:59519195-59519217 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260627 4:59519233-59519255 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260631 4:59519245-59519267 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260635 4:59519257-59519279 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260648 4:59519295-59519317 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260661 4:59519333-59519355 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260674 4:59519371-59519393 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260678 4:59519383-59519405 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260682 4:59519395-59519417 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260695 4:59519433-59519455 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260699 4:59519445-59519467 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260703 4:59519457-59519479 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260707 4:59519469-59519491 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
984972223 4:185201997-185202019 CCTTTAGCTGGGTCTGCAGCTGG - Intronic
992417482 5:76565832-76565854 CCATTAGGTGGTTCTGCAGGAGG - Intronic
993903075 5:93597195-93597217 CCTTCATGCGGGGCGCCAGGGGG + Intergenic
998433688 5:142088687-142088709 CCTTCCGGCGTATCTGCAGTGGG + Intergenic
999126432 5:149249669-149249691 AGTTCAGGAGGGGCTGCAGGAGG + Intronic
999382435 5:151131027-151131049 ACGTCAGGCAGGTATGCAGGTGG + Intronic
1002093475 5:176817798-176817820 CCGTCGGGCGGGGCTGCGGGAGG + Intronic
1009187416 6:60589725-60589747 CCTTCACCCGGATCAGCAGGTGG + Intergenic
1019122570 6:169814535-169814557 CCATCAGCGTGGTCTGCAGGTGG - Intergenic
1019246412 6:170712957-170712979 CCAGCAGGCGGCGCTGCAGGAGG - Intergenic
1019552627 7:1610704-1610726 CCTTCTGTCTGGCCTGCAGGGGG - Intergenic
1019667231 7:2257928-2257950 CCACCAGCCAGGTCTGCAGGGGG + Intronic
1019989473 7:4682013-4682035 CCTCCCCGCGGGGCTGCAGGCGG - Intergenic
1024076986 7:45826211-45826233 CATACAGGAGGGTCTGCTGGTGG - Intergenic
1025127435 7:56355206-56355228 CATACAGGAGGGTCTGCTGGTGG + Intergenic
1029193904 7:98791079-98791101 CATTCAGGAGGGTTTGCTGGTGG - Intergenic
1029557713 7:101281928-101281950 CATGCAGGAGGGTCTGCTGGTGG + Intergenic
1029980355 7:104872787-104872809 GCTTCAGGCAGGTCCTCAGGTGG - Intronic
1031888932 7:127271848-127271870 GCCTCAGGCAGGTCTTCAGGAGG - Intergenic
1032414590 7:131726281-131726303 TCTTCTGGCCGGGCTGCAGGTGG + Intergenic
1033447714 7:141436973-141436995 CCTGCATGCAGGGCTGCAGGAGG - Intronic
1036131606 8:6119950-6119972 CCTTGAGGAGGTCCTGCAGGAGG - Intergenic
1036453633 8:8890967-8890989 CCTGCAGGCGGGTCTGACCGAGG - Exonic
1037547575 8:19939554-19939576 CCACCCGCCGGGTCTGCAGGTGG - Intronic
1040957879 8:52997868-52997890 CCTTCAGATGGGTTTGCAGTTGG + Intergenic
1042210921 8:66379678-66379700 CTATCAGGCAGGTATGCAGGCGG - Intergenic
1046371153 8:113308784-113308806 CCTTAAAGAGGGTCTACAGGTGG - Intronic
1047338747 8:123959755-123959777 GCTTCAGGAGTGTCTGAAGGTGG + Intronic
1048948680 8:139474725-139474747 CCTTCTGGTGCGTCTGCAGTTGG + Intergenic
1049229041 8:141472698-141472720 CCTGGAGGCGGGTGTCCAGGGGG + Intergenic
1049337813 8:142095871-142095893 CATCCAGACGGGGCTGCAGGAGG + Intergenic
1049399902 8:142420411-142420433 CCTACAGGCAGGGCAGCAGGCGG + Intergenic
1049897016 9:117948-117970 GCTCCAGCCGGGGCTGCAGGTGG - Exonic
1053292225 9:36888767-36888789 CCTCCAGGCAGCTCTGCAGGCGG + Intronic
1053740116 9:41128200-41128222 GCTCCAGCCGGGGCTGCAGGTGG - Exonic
1054443080 9:65284194-65284216 ACTCCAGCCGGGGCTGCAGGTGG - Exonic
1054487201 9:65737307-65737329 GCTCCAGCCGGGGCTGCAGGTGG + Exonic
1054688234 9:68303113-68303135 GCTCCAGCCGGGGCTGCAGGTGG + Exonic
1056581546 9:87890440-87890462 CCTTCTGGGGGGTCTTCATGGGG - Intergenic
1057081531 9:92177576-92177598 CCATCTGGTGGGTCTGCAGCGGG - Intergenic
1057151078 9:92796607-92796629 CCTGGAGGCTGCTCTGCAGGGGG - Intergenic
1060635457 9:125196502-125196524 CAATGAGGTGGGTCTGCAGGAGG - Intergenic
1061256276 9:129455467-129455489 CCTTCAGGCTGGACGGCAGCAGG + Intergenic
1061540484 9:131275710-131275732 GCTTTAGGCAGGTATGCAGGTGG - Intronic
1061817321 9:133205083-133205105 CCTGAGGGCGGCTCTGCAGGAGG + Intergenic
1062262955 9:135671917-135671939 CCTTCACGGGAGTCTGAAGGAGG + Intergenic
1062278909 9:135743362-135743384 CCTTCAGCGCGGTCTCCAGGAGG + Intronic
1062378138 9:136274176-136274198 CCTCCAGGCTGGCCTCCAGGTGG - Intergenic
1062591582 9:137277012-137277034 CCTTTAGGCAGGCCGGCAGGGGG + Intergenic
1195989341 X:110667215-110667237 CCTTCAGGCTGGAGTGCAGTGGG + Intergenic
1200708248 Y:6461418-6461440 TCTTCAGGCTGGTTTGCAGCCGG + Intergenic
1201025864 Y:9703290-9703312 TCTTCAGGCTGGTTTGCAGCCGG - Intergenic
1202391946 Y:24380002-24380024 CATTCAGGCAGCTCTGAAGGGGG + Intergenic
1202478839 Y:25290115-25290137 CATTCAGGCAGCTCTGAAGGGGG - Intergenic