ID: 970604403

View in Genome Browser
Species Human (GRCh38)
Location 4:17665899-17665921
Sequence ACTAAGAAGCAGCAACTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970604403 Original CRISPR ACTAAGAAGCAGCAACTGGG GGG (reversed) Intronic
900800494 1:4734191-4734213 TCTAAGAAGGAGCATCTGAGCGG - Intronic
902247652 1:15131869-15131891 ACTGAGAAACAGCAGCTGGTTGG + Intergenic
902491574 1:16786193-16786215 ACTATGAGGCAGCAACTTGCAGG + Intronic
904644187 1:31953772-31953794 ACAAAAAAGCAGCTACTGGCCGG - Intergenic
905043100 1:34976561-34976583 ACGAAGAAGCAGCAGATGAGTGG + Intergenic
905093235 1:35446685-35446707 ACTAAGAAACAGCAATCAGGTGG - Intronic
905345591 1:37309049-37309071 TTTAAGAAACAGCCACTGGGGGG + Intergenic
905886965 1:41496695-41496717 GCAAAGAATCAGCAACTGCGGGG + Intergenic
905890468 1:41515667-41515689 ACTAAGAAGCAGGGAATGGTCGG + Intronic
908576700 1:65467688-65467710 GCCAAGAAGCACGAACTGGGTGG - Intronic
912730324 1:112096597-112096619 ACTGAGAGGCAGGAAGTGGGCGG + Intergenic
919090059 1:192967746-192967768 GCTAAGAAGGAGCAACTCAGAGG + Intergenic
921455435 1:215365594-215365616 ACTAGGAAGCTCAAACTGGGTGG - Intergenic
921719056 1:218450326-218450348 ACTAAGTACCACAAACTGGGTGG + Intergenic
923267182 1:232326228-232326250 ACAAAGTACCACCAACTGGGTGG + Intergenic
923528873 1:234796349-234796371 ACTATGAGGCAGCAACTTGCAGG - Intergenic
923656515 1:235921807-235921829 ACAGAGAACCACCAACTGGGTGG - Intergenic
923823599 1:237474742-237474764 ACAAAGATGCAGTAACTGGTAGG + Intronic
1062780119 10:195898-195920 ACCAAGAAGAAGTAAATGGGAGG + Intronic
1064601549 10:16998545-16998567 ACTAAGTACCACAAACTGGGTGG - Intronic
1064761703 10:18627875-18627897 GCTAGGAAGCTCCAACTGGGTGG + Intronic
1065371605 10:24992364-24992386 CCGAAGAAGCAGCAGTTGGGAGG + Intronic
1067956466 10:50796484-50796506 ATTAAGTAACAGCAAGTGGGTGG - Intronic
1070518559 10:77230725-77230747 CCAAAGAGGCAGGAACTGGGAGG - Intronic
1070556521 10:77532129-77532151 TACGAGAAGCAGCAACTGGGGGG + Intronic
1070737071 10:78870460-78870482 AATAAGAAGGAGAATCTGGGAGG + Intergenic
1073110826 10:101062173-101062195 AGTAAGAAGCTGCTAATGGGGGG - Intronic
1073477985 10:103766995-103767017 ACTAAGCAGCAGATTCTGGGCGG - Intronic
1074089457 10:110235050-110235072 TCTAAGAAGCAGAAATTGGATGG - Intronic
1075418266 10:122281707-122281729 ACCAAGAAGCAGAAAATGGAAGG + Intronic
1075434178 10:122420475-122420497 AATATGAAGCAGGAAGTGGGTGG - Intronic
1079414500 11:20221017-20221039 ACTAGGAATCAGCAAGTGGAAGG + Intergenic
1079669465 11:23149277-23149299 ACAAAGTAGCACAAACTGGGAGG + Intergenic
1080030469 11:27655728-27655750 ACTAAGATGCAGCAATTGCTTGG + Exonic
1080968856 11:37246222-37246244 ACAAAGCAGCTCCAACTGGGTGG - Intergenic
1081556412 11:44166396-44166418 TCTAAGAAGCAGTAGCAGGGAGG + Intronic
1081911019 11:46700217-46700239 ACTAAGAAGAAGAAATTTGGGGG - Intronic
1083535307 11:63461517-63461539 ACTAAGAAGCCGCACCCGAGTGG + Intronic
1087791211 11:102407858-102407880 ACAAAGTACCAGAAACTGGGTGG - Intronic
1089671941 11:120062768-120062790 ACTAAGGAGAAGCGTCTGGGTGG - Intergenic
1090172353 11:124616161-124616183 ACCAAGCACCACCAACTGGGTGG + Intronic
1091036805 11:132241876-132241898 GTTAAGAAGCAGCATTTGGGAGG + Intronic
1091082299 11:132682082-132682104 GCTATGCAGCAGCATCTGGGGGG - Intronic
1092239443 12:6828175-6828197 AATAAGAGGGAGAAACTGGGAGG - Intronic
1093424205 12:19010195-19010217 ACAAAGTACCAGAAACTGGGTGG + Intergenic
1097272015 12:57781457-57781479 TCTAAAAAGCAGGAAATGGGTGG - Exonic
1098338909 12:69431743-69431765 ACTAAGTACCACAAACTGGGTGG - Intergenic
1101257521 12:102993131-102993153 ACTAAGAAGCAGAAGCTAGGAGG + Intergenic
1104346976 12:128009160-128009182 TCTCAAAAGCAGCATCTGGGAGG + Intergenic
1105914809 13:24903598-24903620 ACAAAGTACCAGCAACTGGGTGG - Intronic
1108026945 13:46188033-46188055 GCTAAGAGGCAGGAAATGGGAGG - Intronic
1110586499 13:77199509-77199531 GCCAAGAAGCTCCAACTGGGTGG + Intronic
1111913980 13:94342105-94342127 AGTGAGAAGAAGCATCTGGGAGG - Intronic
1112344868 13:98580796-98580818 ACAAAGAACCACCAACTGGATGG + Intergenic
1112464133 13:99629012-99629034 ACGAAGCAGCAGGAACTGGGCGG - Intronic
1114705585 14:24723275-24723297 ACTAAGACACAGCCACAGGGAGG + Intergenic
1116634470 14:47377709-47377731 ACCAGGAAGCTCCAACTGGGTGG + Intronic
1117097789 14:52315150-52315172 AATGAGAAGCAGCAGCAGGGTGG - Exonic
1117673238 14:58129116-58129138 ACTAAGTACCACAAACTGGGTGG - Intronic
1117804481 14:59476814-59476836 ACAAAGAAGCAGGCACTGGCAGG + Intronic
1118507035 14:66424806-66424828 ACTAAGTACCACAAACTGGGTGG + Intergenic
1118973607 14:70657984-70658006 ACAAAGAAACAGCCACTTGGAGG + Intronic
1119895547 14:78216676-78216698 ACAAAGTACCAGCAACTGGGTGG + Intergenic
1122616148 14:103019320-103019342 TCCAAGTTGCAGCAACTGGGAGG + Intronic
1123627688 15:22238911-22238933 ACTAACAAGCAGCCTCTGGCTGG - Intergenic
1126098480 15:45105814-45105836 ACTAAACAGCAGCACCTGGGTGG + Exonic
1126240234 15:46433459-46433481 ATTAAGCAGGGGCAACTGGGTGG + Intergenic
1130241338 15:82195717-82195739 GCTCAGAAGCAGCACCTGGGAGG + Intronic
1130459085 15:84145436-84145458 GCTCAGAAACAGCACCTGGGAGG - Intergenic
1130641312 15:85678287-85678309 ACTTAGAATCAGCAAGTGGTAGG - Intronic
1130809843 15:87365335-87365357 ACTAGGAAGAAGGAACTGGCAGG + Intergenic
1131612955 15:93984185-93984207 ACCAAGAACCTGCAACTGAGTGG - Intergenic
1133407178 16:5534078-5534100 ACAAAGCGGCAGCAACTGGCAGG - Intergenic
1133536534 16:6707702-6707724 GCTATGGAGCAGAAACTGGGAGG - Intronic
1133571947 16:7049691-7049713 ATTAAAAAGCAGCAAGTGGAGGG - Intronic
1134249397 16:12563799-12563821 AATAAAAAGCAGCAAATGGGTGG - Intronic
1135377187 16:21957535-21957557 TGTAAGACGCAGCAAATGGGTGG - Exonic
1136034070 16:27525454-27525476 ACAAAGAAGGAACAGCTGGGAGG - Intronic
1137445162 16:48527126-48527148 ACCAGGAGGCAGCAACTGGCTGG + Intergenic
1137667078 16:50257261-50257283 ACTCAGAAGCAGCAAGTGGAAGG + Intronic
1138677938 16:58665528-58665550 TCTAAGAAGCAGAAGCTGGTTGG - Exonic
1138797628 16:59989128-59989150 ACCATGAAGCAGGAACTGGGGGG - Intergenic
1141964041 16:87429492-87429514 AGTAAGAAGCAGCAACTTGTTGG + Intronic
1141976267 16:87518442-87518464 ACTAACAAGCAGCCTCTGGCTGG + Intergenic
1142817580 17:2439051-2439073 ACTAAAAACCAGAAACTGGGAGG + Intronic
1143123380 17:4624210-4624232 ACTAATAAGCAGAAGCGGGGTGG - Intergenic
1143143631 17:4758331-4758353 ACTGGGAGGCAGCTACTGGGAGG - Intergenic
1144674416 17:17152815-17152837 AGGAAGGAGCAGCACCTGGGAGG + Intronic
1146212986 17:30956469-30956491 AGTAAGAAGCAGGAACTGAGGGG + Exonic
1146282341 17:31552784-31552806 ACTAAGGAGGAGCAAAAGGGAGG - Intergenic
1146776381 17:35621228-35621250 ACTTTGAGACAGCAACTGGGTGG - Intronic
1150044115 17:61894553-61894575 ACAAAAAAGCAACAACTGGCCGG + Intronic
1150129591 17:62660422-62660444 AGCAAGAAACAGCAGCTGGGAGG + Intronic
1150506558 17:65704317-65704339 ACAAAGAACCAAAAACTGGGTGG - Intronic
1151257672 17:72891505-72891527 ACTGGGGAGCAGCAAGTGGGAGG - Intronic
1152421830 17:80197802-80197824 AGTGAGGAGCTGCAACTGGGAGG - Intronic
1153441297 18:5122473-5122495 GCTAGGAAGCATGAACTGGGTGG + Intergenic
1157376663 18:47173687-47173709 ACAAAGCAGCACAAACTGGGTGG + Intronic
1157378820 18:47192212-47192234 ACTAATAAGCAGCAACTGAGAGG - Intergenic
1159561184 18:69996584-69996606 ACTAAGAAGCAGGGCCTGGAAGG + Intergenic
1159729926 18:72013435-72013457 ATGAAGAACCAGCCACTGGGGGG - Intergenic
1163320796 19:16573367-16573389 AATTAGAAGCAGCAACCGGCTGG + Intronic
1163410988 19:17154405-17154427 ACCAAGAAGCAGTAAGTGTGCGG + Exonic
1167509647 19:49889316-49889338 TCTCACAAGCAGCAGCTGGGAGG - Intergenic
1168141126 19:54388081-54388103 CCTAAGTAGCAGCAACTTGCGGG + Intergenic
1168348992 19:55665212-55665234 ACTAAGCACCAGCAAGTGGCGGG - Intronic
925652989 2:6111951-6111973 AGTAAGCAGCAGAAACTGGCAGG + Intergenic
926751973 2:16205072-16205094 AAGAAGAAGCAGCTCCTGGGAGG - Intergenic
927197221 2:20556726-20556748 ACTAAAATGCAGCAACTGATGGG - Intergenic
927518220 2:23684202-23684224 ATAAACAAGCAGCCACTGGGAGG - Intronic
927644420 2:24867873-24867895 ACTAATAAGCAGAAAGTGGGGGG + Intronic
928163866 2:28955224-28955246 CCTAAGAATCAGCAAGTGGCTGG - Intergenic
928254809 2:29712942-29712964 ACAAAGTACCATCAACTGGGTGG + Intronic
929412995 2:41718027-41718049 AAGTAGAGGCAGCAACTGGGTGG + Intergenic
932026156 2:68135438-68135460 ATTAAAAACCAGCAACTGGAAGG + Intronic
934819475 2:97359711-97359733 AGTAAAAAGGAGCAAGTGGGAGG - Intergenic
935202271 2:100868359-100868381 AATAAGGAACAGCAACTGGATGG - Intronic
936081327 2:109434562-109434584 ACTCAGAAGCAGGAAGAGGGTGG - Intronic
936230467 2:110695795-110695817 ACCAGGAAGCAGCAATGGGGTGG + Intergenic
936590546 2:113799754-113799776 ACAAAGAAGCAGGAAGTGGGGGG - Intergenic
938833403 2:135074847-135074869 ACTAAGAGGCAGGAGCTGGAGGG + Intronic
939108976 2:137983884-137983906 ATTAAGAAGCAGCAAATGGAAGG - Intronic
939193363 2:138942623-138942645 GCCCAGAAGCAGGAACTGGGTGG - Intergenic
939494819 2:142915367-142915389 AATAAGAAGCAGCAGCAGTGAGG + Intronic
939836647 2:147137309-147137331 ACAAAGAACCACAAACTGGGTGG + Intergenic
940089152 2:149896743-149896765 GCTCAGCAGCAGCACCTGGGAGG + Intergenic
940259075 2:151761715-151761737 ACAAAGTACCACCAACTGGGTGG - Intergenic
940275235 2:151933085-151933107 ACAAAGTACCACCAACTGGGTGG - Intronic
940358609 2:152772539-152772561 ACTAAAGAGCAGCCACTTGGTGG + Intergenic
941014881 2:160344256-160344278 ACTTGTAAGCAGCAACTGGGGGG + Intronic
942352014 2:175062814-175062836 ACTCAGCAGCAGGAAGTGGGGGG + Intergenic
942662618 2:178282347-178282369 ACTAAGCAGCAGCAGAGGGGAGG - Intronic
945064538 2:205937648-205937670 ACCAAGAAGCAGCAAATTGTTGG - Intergenic
945831847 2:214796658-214796680 ACAAAGAACCAAAAACTGGGTGG - Intronic
946530370 2:220563981-220564003 ACTACGATGAAGCAACTTGGAGG - Intergenic
948159420 2:235812045-235812067 ACTGAGAAACAGCACCTTGGCGG - Intronic
1169742114 20:8906318-8906340 AGGAAGATGCAGGAACTGGGAGG - Intronic
1169803512 20:9535791-9535813 AGGAAGAGGTAGCAACTGGGAGG + Intergenic
1169807481 20:9574377-9574399 AGTTTGAAGCAGCAACTGTGGGG - Intronic
1170049743 20:12129212-12129234 ACAAAGCAGCTCCAACTGGGTGG - Intergenic
1170549082 20:17460343-17460365 AATAAGCAGAAGCCACTGGGTGG - Intronic
1171748339 20:29022422-29022444 GCCAGGAAGCAGGAACTGGGTGG + Intergenic
1171871226 20:30527559-30527581 ACAAAGTACCAGAAACTGGGTGG + Intergenic
1173006959 20:39147274-39147296 AGTAAGTAGCAGAAAGTGGGGGG - Intergenic
1173399588 20:42712420-42712442 ACTGAGTATCATCAACTGGGAGG - Intronic
1174064345 20:47853719-47853741 TCTCAGAAGCAGGAACTGGGGGG + Intergenic
1175460791 20:59150587-59150609 ACTCAGAACCATCATCTGGGAGG + Intergenic
1175617635 20:60414795-60414817 CCTAAGAAGCAGAAACTGTGTGG - Intergenic
1178520918 21:33287963-33287985 TCTCAGAAACAGCAACTGGTTGG - Intronic
1178813537 21:35906199-35906221 ACTGAAAACCAGCCACTGGGAGG - Intronic
1178898325 21:36578955-36578977 ACAAAGTACCACCAACTGGGTGG + Intergenic
1179907595 21:44432149-44432171 ACTAAGTACCACAAACTGGGGGG + Intronic
1181450406 22:23016541-23016563 ACTAATCAGCAGGAAGTGGGTGG - Intergenic
1182359550 22:29738508-29738530 ACAAAGCAGAAGCAACTGGTAGG + Intronic
1182854088 22:33501894-33501916 ACAAAGTAGGAGGAACTGGGTGG + Intronic
1183079237 22:35445909-35445931 ACTGAGAAGTACCATCTGGGAGG - Intergenic
1183932155 22:41241221-41241243 ACTAGGAAGCAGCCTCTGGGAGG - Intergenic
1184742061 22:46434324-46434346 AGTCAGCAGCAGCAGCTGGGAGG + Intronic
950021347 3:9789848-9789870 CCCAAGAAGCAGAAACTGGAAGG - Exonic
950549592 3:13658114-13658136 ACAAAGAAGCAGCAAGGGAGGGG - Intergenic
951609461 3:24476034-24476056 ACCAAAGAGCAGCAGCTGGGTGG - Intronic
952614737 3:35256944-35256966 ATTAAGAATCAACAACTTGGGGG - Intergenic
952975138 3:38687582-38687604 AATCAGAATCAGAAACTGGGTGG - Intergenic
954497477 3:50978669-50978691 GCCAAGAAGCTCCAACTGGGTGG - Intronic
956276227 3:67504354-67504376 GCTAACAAGAAGCAACGGGGTGG + Intronic
956391784 3:68780785-68780807 ACAAATAATCAGCAACTGGCTGG + Intronic
959794473 3:110407726-110407748 AATAAGAAGAAGAAAGTGGGAGG - Intergenic
960283966 3:115807070-115807092 ACTGAAAAGCACCAACTGGTTGG - Exonic
960557526 3:119045611-119045633 GCCAAGAAGCTCCAACTGGGTGG + Intronic
965845681 3:172958603-172958625 ACAAAGTACCACCAACTGGGTGG + Intronic
967500015 3:190186647-190186669 ACTAAGAAGCAACAGCTTGATGG + Intergenic
968770380 4:2501838-2501860 ACTAAGAAGCAACACCTATGGGG - Intronic
969421289 4:7098000-7098022 ACAAAGTACCACCAACTGGGTGG - Intergenic
970604403 4:17665899-17665921 ACTAAGAAGCAGCAACTGGGGGG - Intronic
971267197 4:25106116-25106138 ACTAAGTACCACAAACTGGGTGG - Intergenic
971441724 4:26694393-26694415 ACTAGGAAGCTCGAACTGGGTGG + Intronic
972104629 4:35467644-35467666 CCTTAAAAGCAGCAACTTGGGGG - Intergenic
972157485 4:36182194-36182216 AGTAAGATGCAGAAACTGGCCGG + Intronic
972627562 4:40815988-40816010 ACAAAGCATCAGCAACTGGATGG + Exonic
975444779 4:74449813-74449835 ACAAAAAAGCAGCAAATGGCTGG + Intronic
975684058 4:76902341-76902363 ACTTAGAAGGAGCAGCTGGAGGG + Intergenic
976094692 4:81495917-81495939 AACAAGAAGCAGCTACTAGGTGG + Intronic
978256377 4:106697321-106697343 ACAAAGTATCACCAACTGGGTGG + Intergenic
979312406 4:119219183-119219205 ACAAAGAACCACAAACTGGGTGG + Intronic
980845959 4:138325384-138325406 ACAAAGTAGCACAAACTGGGTGG + Intergenic
982836513 4:160125733-160125755 GCCAGGAAGCAGGAACTGGGTGG - Intergenic
984414985 4:179446615-179446637 ACAAAGAAGCACAAACTGGATGG + Intergenic
984879922 4:184401697-184401719 CCTAAGAAGCAGCTGGTGGGTGG + Intronic
987264536 5:16238568-16238590 ACTGAGGAGTAGCCACTGGGTGG - Intergenic
987268586 5:16281169-16281191 ACAAAGAACCACAAACTGGGCGG + Intergenic
987283450 5:16434684-16434706 TCTCAGAAACAGCACCTGGGAGG + Intergenic
989001158 5:36762292-36762314 ACAAAGTACCATCAACTGGGTGG + Intergenic
989940639 5:50145930-50145952 ACTGGGAAGCACGAACTGGGGGG + Intergenic
990396505 5:55385408-55385430 ACTTAGCAGCAGCAACAGGTAGG + Intronic
990723009 5:58719544-58719566 ACAAAGAGGCACAAACTGGGTGG + Intronic
990819848 5:59825823-59825845 CCTGAGAATCAGCAGCTGGGAGG + Intronic
991298518 5:65105196-65105218 ACTAAGAAGTAGCAAGAGAGAGG - Intergenic
991939981 5:71841372-71841394 ACAAAGTAGCACAAACTGGGTGG - Intergenic
991971231 5:72143651-72143673 ACAAAGTATCATCAACTGGGTGG + Intronic
994145624 5:96391877-96391899 AATCAGAAGCAGAAACTGGCAGG - Exonic
994625975 5:102219523-102219545 AATATGAAGCAGCAAGTGCGTGG + Intergenic
994897163 5:105721319-105721341 TCTAAGAAGGAGCTCCTGGGAGG + Intergenic
995093893 5:108213059-108213081 ACTGAGAAGTTCCAACTGGGTGG - Intronic
997415927 5:133728548-133728570 ACTAAAAAGATGCAACTGGCAGG + Intergenic
998723696 5:144984725-144984747 ACAAAGAACCACAAACTGGGTGG + Intergenic
998955656 5:147435697-147435719 ACTTAGAAACAGCAAGTGGCAGG + Intronic
1000939116 5:167338706-167338728 TCAAAGAAGCAGGAACTGGGTGG + Intronic
1002675349 5:180908043-180908065 ACAAAGCAGCTCCAACTGGGTGG - Intronic
1007123449 6:39402664-39402686 ACTGAGAAGCCCCCACTGGGTGG + Intronic
1008261470 6:49370826-49370848 ACTAAAAAGCAGCTTCTGGCAGG - Intergenic
1009040472 6:58170207-58170229 TCTTAGAAGCAGTAACTGAGGGG - Intergenic
1009216329 6:60924744-60924766 TCTTAGAAGCAGTAACTGAGGGG - Intergenic
1012085813 6:94824643-94824665 GCCAAGAAGCTCCAACTGGGTGG + Intergenic
1013186011 6:107758833-107758855 ACAAAGAACTACCAACTGGGTGG - Intronic
1013867502 6:114716434-114716456 CCTAATAAAAAGCAACTGGGTGG - Intergenic
1014637877 6:123871367-123871389 TCCAAGAAGCAGCAACTAAGAGG - Intronic
1015050105 6:128829947-128829969 GCTAGGAAGCTCCAACTGGGTGG + Intergenic
1016523858 6:144977375-144977397 ACCGGGAAGCAGAAACTGGGTGG - Intergenic
1016560993 6:145395134-145395156 ACTATCAAGCAGCAGCTTGGAGG + Intergenic
1017035886 6:150266923-150266945 ACGAAGTAGCAAAAACTGGGTGG + Intergenic
1017809620 6:157975509-157975531 ACAAAGTACCAACAACTGGGTGG + Intergenic
1017947508 6:159107668-159107690 ACTCAGAAGTATGAACTGGGGGG - Intergenic
1019388804 7:773888-773910 ACTGAGAAGCAGCTCCTGAGAGG + Intronic
1020922187 7:14279349-14279371 ACTGGGAAGCTCCAACTGGGTGG + Intronic
1023328463 7:39086142-39086164 ACTAAAAAGGAGCATCTTGGAGG + Intronic
1024678597 7:51660581-51660603 ACAAAGTAGCACAAACTGGGTGG + Intergenic
1025639311 7:63352594-63352616 ACTCAGAAGCAGAGAGTGGGAGG - Intergenic
1025643388 7:63395498-63395520 ACTCAGAAGCAGAGAGTGGGAGG + Intergenic
1026711774 7:72747618-72747640 ACAAAGAAGAAAGAACTGGGAGG - Intronic
1027925614 7:84459057-84459079 ATTAAAAAGCAGGAGCTGGGAGG - Intronic
1027990739 7:85357724-85357746 ACAAATATTCAGCAACTGGGTGG - Intergenic
1029007907 7:97229858-97229880 ACTAAGTACCACCAACTGGGTGG + Intergenic
1029537548 7:101165133-101165155 ACTAAGCAGCAGCAATATGGGGG + Intronic
1029986622 7:104928676-104928698 ACAAAGAACCACCGACTGGGTGG - Intergenic
1033062247 7:138120361-138120383 ACTAAGTACCACAAACTGGGTGG - Intergenic
1033466571 7:141596043-141596065 ACTAAATAGCAGCAACTGGCAGG - Intronic
1034426023 7:151014423-151014445 ACTAAGAAACAGGAAGCGGGTGG - Exonic
1034549884 7:151813761-151813783 CCAAAGAAGCAGCAGATGGGAGG - Intronic
1035431046 7:158821998-158822020 AGTTAGAAGAAGCACCTGGGAGG - Intronic
1035912866 8:3587278-3587300 GCTCAGAAGAAGTAACTGGGTGG - Intronic
1038318908 8:26511187-26511209 ACTCCGCAGCAGTAACTGGGAGG - Intronic
1039491393 8:37950285-37950307 ACTGAGAAGCAGCAGCAGTGAGG - Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040794277 8:51271987-51272009 ACCAATCAGCAGGAACTGGGTGG + Intergenic
1041573149 8:59360720-59360742 ACTTATAAGCAGCAAATGGTAGG - Intergenic
1042916694 8:73882429-73882451 ACTAAGAACAAACTACTGGGTGG - Intergenic
1043771357 8:84205803-84205825 ACAAAGTAGCAGAGACTGGGTGG + Intronic
1044706849 8:95017236-95017258 ATTAAGAAGCACCAGATGGGCGG - Intronic
1045508563 8:102795541-102795563 AAAAAGAACCAGCAACTGGGAGG - Intergenic
1045555845 8:103213741-103213763 AGTCAGAAGGAGGAACTGGGTGG - Intronic
1045687141 8:104723897-104723919 ACTCAGGAGTAGCCACTGGGAGG + Intronic
1047361885 8:124176624-124176646 ACAAAGTACCACCAACTGGGTGG - Intergenic
1048513475 8:135082810-135082832 ACTAAAAAGCAGGAACAGAGGGG + Intergenic
1050407703 9:5327394-5327416 GCTAGGAAGCACAAACTGGGTGG + Intergenic
1051149195 9:14062154-14062176 ACAAAAAAGCAGCAGCTGGATGG + Intergenic
1052579369 9:30334347-30334369 ACAAAGAAGCACAGACTGGGTGG - Intergenic
1054708140 9:68483810-68483832 TCAGAGAACCAGCAACTGGGTGG - Intronic
1056958421 9:91101180-91101202 CCTAAGAACCCGCAACTGGAAGG + Intergenic
1058313888 9:103539989-103540011 ACAAAGAAGGAGCTACTGGAGGG + Intergenic
1059836498 9:118160331-118160353 ACTGAGAAGGAGCAACCTGGTGG - Intergenic
1061212213 9:129200420-129200442 ACCATGAGGCAGCAACTGTGAGG - Intergenic
1061674323 9:132207261-132207283 ACTAAGTACCACTAACTGGGTGG + Intronic
1062657862 9:137613490-137613512 ACCAGGAAGCAGGAACTGGAAGG - Exonic
1187113156 X:16322129-16322151 GCTGAGAAGCTCCAACTGGGTGG + Intergenic
1187130484 X:16497834-16497856 GCTGAGAAGCTCCAACTGGGTGG + Intergenic
1187562494 X:20415754-20415776 AATAAGAACCAACAACTTGGTGG + Intergenic
1190840820 X:54142585-54142607 ACCCAGAAGCTGGAACTGGGTGG + Intronic
1192910018 X:75593469-75593491 ACAAAGTACCAGCAACTGGGTGG - Intergenic
1194924257 X:99805679-99805701 ACCAGGAAGCTGGAACTGGGTGG + Intergenic
1195564574 X:106325929-106325951 AACAAGAAGCAGCAACCAGGGGG + Intergenic
1197231211 X:124005767-124005789 ACAAAGTAGCACAAACTGGGTGG + Intronic
1197408329 X:126083827-126083849 ACTCAGAAGCAGCAGCTCGGAGG - Intergenic
1197574863 X:128199419-128199441 GCTGGGAAGCACCAACTGGGTGG + Intergenic
1198581838 X:138073892-138073914 ACTAGGAAGCTCGAACTGGGTGG + Intergenic
1198677686 X:139148159-139148181 ACCAAGTAGGAGCAACTGGAAGG + Intronic
1198874442 X:141207886-141207908 ACAAAGAAGCACAGACTGGGTGG - Intergenic
1198944571 X:141996131-141996153 ACTAAGAAACAGCTCCTGGCAGG - Intergenic
1201913620 Y:19158516-19158538 ACCAGGAAGCTGGAACTGGGTGG + Intergenic