ID: 970604729

View in Genome Browser
Species Human (GRCh38)
Location 4:17668325-17668347
Sequence CAAGCTACTAAGAATGATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970604729 Original CRISPR CAAGCTACTAAGAATGATAT AGG (reversed) Intronic
907614595 1:55911379-55911401 CAAGATACTATGGATAATATTGG - Intergenic
908103997 1:60822293-60822315 GCAGCTACTAAGAGTGAAATTGG + Intergenic
909683867 1:78323792-78323814 CAAACTACTATGAATATTATGGG + Intronic
912970598 1:114278658-114278680 AAAGCTACTAAGTATAATTTGGG - Intergenic
916882975 1:169039446-169039468 CAACCTACCAAGATTGAAATAGG + Intergenic
922126482 1:222730482-222730504 CAAGCTACTCAGGATGAGGTGGG + Intronic
923761056 1:236844528-236844550 TAAGCTAATGAGAATGATCTGGG + Intronic
1069225706 10:65941692-65941714 CAAGATACTAAATATGAAATGGG - Intronic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1079402983 11:20120986-20121008 CAAACTGCCAAGAATGATACAGG + Intronic
1080509554 11:32954458-32954480 CAAACTACTAATAATGAATTGGG - Intronic
1082891877 11:58148023-58148045 CAATTTACCAACAATGATATTGG + Intronic
1086868462 11:92008695-92008717 CAAGCTACATAGAATGATTTAGG + Intergenic
1087904614 11:103681233-103681255 TAAACCACTTAGAATGATATTGG - Intergenic
1087998019 11:104835818-104835840 CAAGCTACTAAGAATGAAGCAGG - Intergenic
1088972542 11:114786692-114786714 CAAACTAGAAACAATGATATGGG - Intergenic
1092329581 12:7571339-7571361 TAAGTGACTAAGAAAGATATGGG + Intergenic
1096194247 12:49639259-49639281 CAAGATACTAAAACTGATAGTGG + Exonic
1098045907 12:66400386-66400408 CAAGCTCCCAAGAATGATCTTGG - Intronic
1100164023 12:91895801-91895823 CAAGCTATTAACAATGATCCTGG + Intergenic
1100853804 12:98740417-98740439 CAAGCTCCTGAGAATGTTATGGG - Intronic
1102443554 12:112982887-112982909 CAACCTACTAAGATTGATCCAGG - Intronic
1105714375 13:23047537-23047559 CAACCTACTAAGACTGAAAAAGG + Intergenic
1107797113 13:44064325-44064347 CAAGTAACTAAGCATGATATAGG + Intergenic
1107848286 13:44542852-44542874 GAAGCTCCTAAAAATGATACAGG + Intronic
1109341805 13:61071285-61071307 CTAGCTACTAAAAATGATTTTGG + Intergenic
1109450629 13:62509656-62509678 CAACCTTCTAAGACTGAAATAGG - Intergenic
1109453755 13:62555133-62555155 CAAACTACAAAGATTGAAATAGG - Intergenic
1111413747 13:87912116-87912138 CAAGTTTCTAAAAATGATATGGG + Intergenic
1111610586 13:90601677-90601699 CAACATATTAAGAATGGTATAGG - Intergenic
1111762903 13:92487728-92487750 CAAGCTACTTAGCCTGAGATGGG - Intronic
1112746653 13:102534426-102534448 CAAGCTACTTTGAATGTTGTAGG + Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1115860374 14:37679358-37679380 CCAACTACTAACAATGATGTAGG - Intronic
1116715744 14:48424033-48424055 GAAGCTACTAAAAATGAGTTAGG + Intergenic
1117644396 14:57836192-57836214 TAAGCAAATAAGAATAATATGGG - Intronic
1118099180 14:62576516-62576538 CAACCTACTAAGATTGAGCTGGG + Intergenic
1120081436 14:80221305-80221327 CAAGCTACTAAGAAATACATGGG + Intronic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1124178110 15:27445838-27445860 CATGCTAAAAAGAATGAAATTGG - Intronic
1126502729 15:49364326-49364348 CAACCTACTAAGATTGAACTAGG - Intronic
1127567524 15:60206738-60206760 CTAACCTCTAAGAATGATATTGG + Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1134284917 16:12852929-12852951 CAAGATAATAATAATGAAATTGG + Intergenic
1137327912 16:47460688-47460710 CAAGCTGTTAAGAATGCTAAAGG + Intronic
1137659883 16:50195516-50195538 CAAGCTACTTGGAATGATACTGG + Intronic
1140072824 16:71667318-71667340 CAAGCTACTCAGAATTCTAAGGG + Exonic
1149722190 17:58856573-58856595 CCAGCACCTCAGAATGATATAGG + Intronic
1150482075 17:65518315-65518337 GAAGCCACTAAGAAGGAAATAGG - Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1155530318 18:26760068-26760090 CAAGCTATTAAGAGTTCTATGGG - Intergenic
1156131958 18:33987385-33987407 AAAGCTTCTAGGAATGACATGGG + Intronic
1156786101 18:40917159-40917181 CAAGGTACTAGGAAAGATATGGG - Intergenic
1158064275 18:53386779-53386801 CAAGATACTGAGAAAGAAATGGG + Intronic
1166848568 19:45745907-45745929 AAAGCCACTGAGACTGATATTGG - Intronic
1167805554 19:51781398-51781420 CTGGCTACTAAGAAGGAAATTGG + Intronic
926703333 2:15818725-15818747 CACGCTATTAAGCCTGATATCGG + Intergenic
927363200 2:22261616-22261638 CTAGCTTCAAAGAATGATTTAGG + Intergenic
929444682 2:41992584-41992606 CAAGTTCCTAAGCATGATATTGG - Intergenic
933347965 2:81113976-81113998 CAAGCTTCCAAGAATGAAATTGG - Intergenic
936503896 2:113089202-113089224 AAAGCTACAAAGAGAGATATAGG + Intergenic
937608997 2:123838098-123838120 CAAGCTACCAAAAATGAACTAGG + Intergenic
938283045 2:130080844-130080866 CAAGCTGCTCACACTGATATTGG - Intronic
938356141 2:130651273-130651295 CAAGCTGCTCACACTGATATTGG + Intronic
938432565 2:131258055-131258077 CAAGCTGCTCACACTGATATTGG + Intronic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
940268038 2:151860846-151860868 CAAGCCAGTAAAAATGTTATGGG + Intronic
942877832 2:180823697-180823719 CAATCTAATATGAATCATATAGG - Intergenic
944207535 2:197172302-197172324 CAAGCTATTAAGAATAATAATGG - Intronic
944953054 2:204775343-204775365 CTAGCTAATAATAATGATAGTGG + Intronic
947230014 2:227875254-227875276 CAAGCTAAAAAGAATGGTAGTGG - Intronic
1172017190 20:31883824-31883846 TCAGCTTTTAAGAATGATATTGG - Intronic
1173004850 20:39132357-39132379 CAAGCTAGTGAGAATTAAATGGG + Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1177017818 21:15814299-15814321 CAAGCTGCTAATAAAGACATAGG - Intronic
1177325538 21:19583637-19583659 CAAGCTTCTAAGTATGCTCTTGG + Intergenic
1178732652 21:35118818-35118840 CAAGCAACTAAAGTTGATATGGG - Intronic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1182136680 22:27911057-27911079 GAAGCTAGTAAGAATGAGACTGG - Exonic
949642713 3:6057294-6057316 CATGTGGCTAAGAATGATATAGG + Intergenic
951798727 3:26571420-26571442 CAAGCTACTTAGAAAGATGAGGG + Intergenic
953128133 3:40111239-40111261 GAAGCTACCAAAAATCATATAGG - Intronic
957244644 3:77702029-77702051 CAAGGGATTAATAATGATATGGG + Intergenic
958003767 3:87786104-87786126 CCAGCTACGAAGCATGATCTTGG - Intergenic
958660796 3:97063883-97063905 CAAGCAATGAAGAATGATTTTGG + Intronic
958663889 3:97108685-97108707 AAAGCTATTAAAAATGAGATAGG - Intronic
963403408 3:144831997-144832019 CAAGCTACAAAGAATGAGAAAGG + Intergenic
963806948 3:149732455-149732477 CAATCTACCAAGAATGAGAGGGG + Intronic
963949845 3:151186996-151187018 GAAGCTAGTAAAAATGAAATAGG + Intronic
964887350 3:161499791-161499813 CAAGCTTATAATAATGACATTGG + Intronic
965096989 3:164242480-164242502 CATACTACTTAGAATGTTATAGG - Intergenic
968718707 4:2182152-2182174 AAAGGTACTAAGAATGGTGTTGG + Intronic
969896257 4:10307844-10307866 CAAGTTACAGAGAATGAAATGGG - Intergenic
970604729 4:17668325-17668347 CAAGCTACTAAGAATGATATAGG - Intronic
970667313 4:18352796-18352818 CAACCTACTAAGATTGAAGTAGG - Intergenic
971592498 4:28485782-28485804 CAAGCTACTAAGATTTGTAGTGG + Intergenic
971707665 4:30068012-30068034 GAAAATACTAAGATTGATATAGG + Intergenic
972883757 4:43458733-43458755 CTAGCTTCTAGGAATGTTATTGG - Intergenic
976366725 4:84240995-84241017 CAAGATCCTAAGGATGGTATGGG - Intergenic
979034722 4:115700433-115700455 CCAGCTGTTAAGAATGATAAGGG - Intergenic
980693249 4:136322875-136322897 CAACTTACTAATAATGACATTGG + Intergenic
981220451 4:142226531-142226553 CAACCTCTTAAGAATTATATTGG - Intronic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
986409565 5:7463876-7463898 CAAGCTACAAAGAAAGCAATGGG + Intronic
987843561 5:23253097-23253119 CCAGCTACTAGGAGTGAAATTGG + Intergenic
991675136 5:69083364-69083386 CAAGCTACCAATTGTGATATCGG - Intergenic
993390801 5:87318216-87318238 CACTGTACTAAGAATGCTATAGG + Intronic
993407332 5:87527760-87527782 CAAGCTCTTAACAGTGATATGGG - Intergenic
995207735 5:109501672-109501694 CAAGATACTTAAAATGACATGGG - Intergenic
995845243 5:116486923-116486945 CAGGTTTGTAAGAATGATATGGG - Exonic
996450822 5:123622348-123622370 AAAACAACTAAGAATGAAATTGG - Intergenic
999862815 5:155666806-155666828 CAAGCTACACAGAATGAGCTTGG + Intergenic
1000513576 5:162212858-162212880 CCAGCTACTCAGGATGATGTGGG + Intergenic
1000905006 5:166954941-166954963 TAAGATGCTAAAAATGATATGGG - Intergenic
1001525688 5:172427004-172427026 CAAGCTACTAAGTATTACCTGGG - Intronic
1004039267 6:11959807-11959829 CAAGATACTAATGATGATATAGG + Intergenic
1005403407 6:25459336-25459358 CCAGCTACTGAGAATGAAGTGGG - Intronic
1008063527 6:47024020-47024042 TAAGCAACTAAGAATGCTCTGGG - Intronic
1009241082 6:61186747-61186769 CAAGCAATAAAAAATGATATAGG + Intergenic
1010226169 6:73491441-73491463 CAAACTGATAAAAATGATATAGG - Intronic
1012574128 6:100770084-100770106 CTAGCTTCTTAGAATGATTTGGG - Intronic
1014427616 6:121327984-121328006 TAAGTTATTAAGCATGATATAGG - Intronic
1014916660 6:127158880-127158902 CAAGCTAGAAAGAATTGTATTGG - Intronic
1015083455 6:129256980-129257002 CAAGCCACTATGAATAATATTGG - Intronic
1016348866 6:143145915-143145937 GAATGTACTAAAAATGATATTGG - Intronic
1018263406 6:161993377-161993399 CAACCTACCAAGAATGAAGTAGG + Intronic
1020799882 7:12720381-12720403 CAATCCACAAAGAATGATAAGGG - Intergenic
1023307922 7:38850363-38850385 CAAACAACTCAGAATGAAATTGG - Intronic
1023469904 7:40505829-40505851 CAAGAAACTAAGAATAAGATAGG - Intronic
1023657354 7:42437700-42437722 CTAGCTTCAAAGAATGATTTAGG + Intergenic
1027902458 7:84135072-84135094 CAGGGTACTAAGAAATATATTGG + Intronic
1027953909 7:84855835-84855857 CAAGAATCTAAGAATGTTATGGG + Intergenic
1028383054 7:90220343-90220365 CAAGCTACCAAGATTGAAATGGG - Intronic
1028567800 7:92252142-92252164 CATGCCACTAATAGTGATATTGG + Intronic
1031406068 7:121389014-121389036 CATTCTTCTAAGAATGAAATTGG + Intronic
1039341774 8:36658378-36658400 CAACCTAATAAAAATGATTTTGG - Intergenic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1040845334 8:51831467-51831489 CAACCAAGTAAGAATGATAATGG - Exonic
1041564925 8:59265931-59265953 CTAGCTACTAAGAAACATAAGGG - Intergenic
1042379701 8:68099250-68099272 GAAACAAGTAAGAATGATATTGG + Intronic
1047691779 8:127362848-127362870 CGAGGAACAAAGAATGATATTGG - Intergenic
1051416088 9:16842187-16842209 CAAGATACTAAAAATCATAGTGG - Intronic
1052539135 9:29785196-29785218 CAACCTACTAAGATTGAACTAGG + Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1186111455 X:6261401-6261423 CAAGCTGCTAAGGATGACCTAGG + Intergenic
1187010973 X:15278905-15278927 CAAACCAATAAGAATAATATAGG - Intergenic
1187527283 X:20065658-20065680 TAAGATACTAAGATTGACATTGG - Intronic
1192671457 X:73146997-73147019 CAACCTACCAAGATTGAAATAGG - Intergenic
1193786369 X:85764258-85764280 CAAGCAACTAAGATTGTAATTGG + Intergenic
1194140618 X:90204461-90204483 CAAACTACCAAGAATAAGATTGG - Intergenic
1195833957 X:109091494-109091516 CAAGCTACCAAGAATGAACGAGG - Intergenic
1196643198 X:118087859-118087881 CAAGCTACTTAGAAGGAACTGGG - Intronic
1200486384 Y:3773587-3773609 CAAACTACCAAGAATAAGATTGG - Intergenic
1200987848 Y:9323521-9323543 CAAGCTACTTAAAATGTTCTAGG + Intergenic
1201361852 Y:13160396-13160418 CATGCTACTATGTGTGATATTGG - Intergenic
1202120178 Y:21512674-21512696 CAAGCTACTTAAAATGTTCTAGG - Intronic
1202122629 Y:21536215-21536237 CAAGCTACTTAAAATGTTCTAGG - Intronic
1202156376 Y:21893168-21893190 CAAGCTACTTAAAATGTTCTAGG + Intronic
1202158824 Y:21916709-21916731 CAAGCTACTTAAAATGTTCTAGG + Intronic
1202185275 Y:22181624-22181646 CAAGCTACTTAAAATGTTCTAGG + Intronic
1202206085 Y:22404771-22404793 CAAGCTACTTAAAATGTTCTAGG - Intronic