ID: 970607629

View in Genome Browser
Species Human (GRCh38)
Location 4:17695407-17695429
Sequence CTTTGAGAGGTGAAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45593
Summary {0: 1, 1: 16, 2: 348, 3: 4897, 4: 40331}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970607629_970607635 22 Left 970607629 4:17695407-17695429 CCTCCCACTTTCACCTCTCAAAG 0: 1
1: 16
2: 348
3: 4897
4: 40331
Right 970607635 4:17695452-17695474 CACCATGCCCAGCTTCACTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970607629 Original CRISPR CTTTGAGAGGTGAAAGTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr