ID: 970607629 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:17695407-17695429 |
Sequence | CTTTGAGAGGTGAAAGTGGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 45593 | |||
Summary | {0: 1, 1: 16, 2: 348, 3: 4897, 4: 40331} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
970607629_970607635 | 22 | Left | 970607629 | 4:17695407-17695429 | CCTCCCACTTTCACCTCTCAAAG | 0: 1 1: 16 2: 348 3: 4897 4: 40331 |
||
Right | 970607635 | 4:17695452-17695474 | CACCATGCCCAGCTTCACTACGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
970607629 | Original CRISPR | CTTTGAGAGGTGAAAGTGGG AGG (reversed) | Intronic | ||
Too many off-targets to display for this crispr |