ID: 970608002

View in Genome Browser
Species Human (GRCh38)
Location 4:17699740-17699762
Sequence TGCAGTCTTCATTCCTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970608002_970608006 -4 Left 970608002 4:17699740-17699762 CCACCAAAGGAATGAAGACTGCA 0: 1
1: 0
2: 2
3: 19
4: 232
Right 970608006 4:17699759-17699781 TGCAGAAATGGCAAACAAATGGG 0: 1
1: 0
2: 0
3: 24
4: 372
970608002_970608005 -5 Left 970608002 4:17699740-17699762 CCACCAAAGGAATGAAGACTGCA 0: 1
1: 0
2: 2
3: 19
4: 232
Right 970608005 4:17699758-17699780 CTGCAGAAATGGCAAACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970608002 Original CRISPR TGCAGTCTTCATTCCTTTGG TGG (reversed) Intronic
900569609 1:3351813-3351835 TGCAGTCTCCAGCCATTTGGGGG + Intronic
901131531 1:6964484-6964506 TGCAGTCTTTGTTTCTTGGGTGG + Intronic
903402626 1:23067299-23067321 TGCAGTCCTCTTTCTTTTTGGGG + Intronic
907279992 1:53341064-53341086 TGCAGCCTCCATTCCTAGGGTGG + Intergenic
907663208 1:56412513-56412535 TGCAGTCTTGTTTCCCTAGGAGG + Intergenic
908546123 1:65163886-65163908 TGCTGTCTTCTGTCCTTGGGTGG + Intronic
908677117 1:66617651-66617673 TTCAGTCTTCATTAACTTGGAGG - Intronic
908677174 1:66618357-66618379 TGCAATCTACATTCCATTGGTGG - Intronic
909128137 1:71701316-71701338 TGAAGTCTTCATTTTCTTGGTGG + Intronic
910560013 1:88579925-88579947 TGCATTCTTCATTCCCTTACAGG + Intergenic
910778253 1:90898098-90898120 TGCAGTTCTCATTCCTTATGAGG - Intergenic
913655984 1:120960121-120960143 TGCAGACTTCTTTCCTTTCCTGG - Intergenic
914224769 1:145711383-145711405 TGTACTCTGCATACCTTTGGAGG + Intergenic
915187354 1:154117797-154117819 TGCAGTCACCACTCCTTTCGTGG + Exonic
915877123 1:159622864-159622886 TGCAGCTTTCATTCTTGTGGAGG - Intergenic
920232462 1:204479797-204479819 TGCAGGATTCATTCCTGTGTGGG + Intronic
920852541 1:209638200-209638222 TGATGTCTTCAATACTTTGGAGG + Intronic
921117175 1:212103784-212103806 TGCAGTCATCAGTTCTTTAGGGG + Exonic
923610650 1:235489826-235489848 TGCAGTTTTAATTTCTTTGTAGG - Intronic
923723816 1:236489379-236489401 TGCAGTTTCCATTACTTGGGAGG - Intergenic
924929158 1:248712092-248712114 GTCAGTCTTCATCCCATTGGTGG - Intergenic
1063009895 10:2011782-2011804 TGCAGGCTTCTTTCCTTTCAGGG - Intergenic
1063679896 10:8177088-8177110 TGCAGTCCCAATTACTTTGGAGG + Intergenic
1065372179 10:24998494-24998516 TGTAGTCTTCACTACTCTGGAGG - Intronic
1065795179 10:29300583-29300605 AATACTCTTCATTCCTTTGGTGG + Intronic
1065947676 10:30621808-30621830 AATACTCTTCATTCCTTTGGTGG - Intronic
1067533348 10:47090632-47090654 TCCAGACTTCATTCCTTTATGGG + Intergenic
1068775102 10:60860560-60860582 TGGAGTTTACATTCCTTTGTGGG - Intergenic
1071133975 10:82432063-82432085 TGCTGCCTTCATTCCTATAGAGG + Intronic
1071900945 10:90119828-90119850 TGCACTCCTCATCCCTTGGGTGG + Intergenic
1072151535 10:92689141-92689163 TGCAGTCTTCAATCCAGTGGGGG - Intergenic
1073848914 10:107591883-107591905 TGCAGTCTTAATTCCTTTCCAGG + Intergenic
1075185408 10:120251962-120251984 TGCAGTCCTCAGCCCTTGGGTGG + Intergenic
1079813034 11:25019560-25019582 TGCAGACTTTATTGTTTTGGTGG - Intronic
1080758732 11:35227305-35227327 TGTAGTCTTAGTTACTTTGGGGG - Intronic
1081693076 11:45091653-45091675 TGCAGACTTCATTCATTCAGCGG + Intergenic
1081938326 11:46919461-46919483 TCTAGTCTTCCTTCCTTTTGTGG + Intergenic
1085804756 11:79625264-79625286 TCCAGTCTTCCAACCTTTGGTGG + Intergenic
1087405348 11:97722852-97722874 TCCAGGCTGCATTCCTGTGGGGG - Intergenic
1090211287 11:124922612-124922634 TGCAGTCTTCGTGCAGTTGGTGG + Intronic
1091488433 12:912045-912067 TGCAAACTTCATTATTTTGGGGG + Intergenic
1093816758 12:23558379-23558401 TTCAGTCTTCATTCATACGGGGG - Intronic
1094234553 12:28148659-28148681 TGCAGTCTTCAGTTCCTGGGTGG + Intronic
1094536886 12:31329241-31329263 TGCAGTTTTCATACCTTCAGAGG - Intergenic
1095492871 12:42753767-42753789 TCCATGCTTCATTCCTTTAGTGG - Intergenic
1096618670 12:52848794-52848816 AGGAGCCTTAATTCCTTTGGGGG - Exonic
1097465884 12:59923936-59923958 TGCAGTCTTCATTACTCTCCTGG - Intergenic
1098948819 12:76617885-76617907 TGCATTATGCATTCATTTGGTGG - Intergenic
1099229653 12:80007409-80007431 TGCAGTGTTCTTTCCTTTTGGGG + Intergenic
1100209728 12:92388605-92388627 TGCAATCTACATTCCATAGGAGG + Intergenic
1100442855 12:94632982-94633004 TGCAGTCCTCGTTACTTGGGAGG + Intronic
1101950819 12:109173543-109173565 ATCAGTCTTAATTCCTCTGGAGG + Intronic
1104357422 12:128100239-128100261 TGTAGTCTTCTTTCCTTCAGGGG - Intergenic
1104533093 12:129591062-129591084 TTCTGCCTTCATTCCTTTTGTGG - Intronic
1105701477 13:22938627-22938649 TGCACTCCTCAGTCCTTGGGTGG + Intergenic
1105987360 13:25580873-25580895 TACTGTTTTCATTCCTTTGTTGG + Intronic
1106023280 13:25934453-25934475 TGCAGCCTTGATTCCAATGGTGG + Intronic
1106070010 13:26401513-26401535 TGCTGTCTTGATTCCCTGGGTGG - Exonic
1106460778 13:29965763-29965785 GGCAGTCTTCCTTCCCTTGGGGG + Intergenic
1108205065 13:48079973-48079995 TGCAGTCTTTATTGTTTTAGGGG - Exonic
1109239614 13:59869432-59869454 TTCAGTCTTCATTCCTTTGATGG - Intronic
1110644095 13:77861511-77861533 AGAAGTATTCATTGCTTTGGGGG + Intergenic
1110911477 13:80971104-80971126 AGCAGTCTTAATTCCTGTAGCGG + Intergenic
1110965214 13:81686182-81686204 GGCAGTGTTCATTCCTGTTGAGG + Intergenic
1111475822 13:88745810-88745832 TGCTGTATTAATTGCTTTGGAGG + Intergenic
1112050840 13:95642841-95642863 TGGAGTCTTTCTTCCTTTGTAGG + Intronic
1112092894 13:96100973-96100995 TGCACTCATCATTCTTTAGGTGG - Intronic
1114945374 14:27674024-27674046 TGCAAACTGCATTCCTTTGGAGG - Intergenic
1115266541 14:31506532-31506554 TGCAGGCTTGGTTTCTTTGGAGG + Intronic
1116609403 14:47047981-47048003 TGCAATCTTCTTTCCTTGGATGG - Intronic
1117195556 14:53336527-53336549 TGGATTCTTCATGCCTTAGGAGG - Intergenic
1119375509 14:74188651-74188673 TGGTGGCTTCATTCCTTTGACGG + Intronic
1119460899 14:74802623-74802645 TGCAATCTTGATTCCTGAGGTGG - Exonic
1119988350 14:79166199-79166221 TGAAATCTTCTTCCCTTTGGTGG + Intronic
1125924842 15:43554402-43554424 TGCAGTCTTAGTTACTTGGGAGG - Intronic
1127555417 15:60082768-60082790 TTCACGCTTCTTTCCTTTGGGGG - Intergenic
1127643336 15:60935748-60935770 TTCATCCTTCATTGCTTTGGAGG + Intronic
1129707719 15:77804283-77804305 GCGAGTCTGCATTCCTTTGGGGG - Intronic
1132347661 15:101118289-101118311 TGCAGCATTCATCCCTCTGGAGG - Intergenic
1132978622 16:2722833-2722855 TGCCCTCTTCATTTGTTTGGTGG - Intergenic
1133103150 16:3491267-3491289 TGGAGACTTCAGTCCTTGGGTGG - Intergenic
1133764824 16:8830539-8830561 TGCTGTCTTCTGTCCTTGGGTGG + Intronic
1135860437 16:26051189-26051211 TGCAATCTCCCTTCCTGTGGGGG + Intronic
1136050802 16:27648544-27648566 TGAGGTCTTCATTCCTCTGCGGG - Intronic
1137792160 16:51184436-51184458 TGCTGTCTACTTTCCTTTGGGGG + Intergenic
1139363418 16:66417996-66418018 TGAAGTCCACAGTCCTTTGGAGG + Intergenic
1141057970 16:80836187-80836209 TGCACTTTTCATTCCTGAGGTGG + Intergenic
1141552085 16:84812982-84813004 TGGAGTCTAAATTCCTTTGCAGG + Intergenic
1143343730 17:6234119-6234141 TGCAGTCATCATTTATCTGGAGG + Intergenic
1144785452 17:17828790-17828812 TGTAGTCTCCATTACTCTGGAGG + Intronic
1146196767 17:30819847-30819869 TGCTTTCCTCTTTCCTTTGGTGG - Intronic
1146256357 17:31393189-31393211 TGCAGTGGTCTTTCCTGTGGTGG - Intronic
1146550117 17:33773362-33773384 AGCAGTCTCCCTGCCTTTGGGGG - Intronic
1147318516 17:39632479-39632501 TGTAGGCTTCAGTCCTTTTGTGG + Intronic
1148164936 17:45476826-45476848 TGCGGTCTACATTCCCATGGAGG - Intronic
1150018095 17:61580317-61580339 TTAAGTCTTCATTCCTTTTCAGG - Intergenic
1152062159 17:78085050-78085072 AGCTGTCTCCTTTCCTTTGGAGG - Intronic
1152759784 17:82101787-82101809 TGCTGTCTTCATCCCTGGGGTGG + Exonic
1153706104 18:7747502-7747524 GGCAGACTTGGTTCCTTTGGAGG + Intronic
1153953189 18:10074248-10074270 TTCAGAATTCTTTCCTTTGGTGG + Intergenic
1154288949 18:13088326-13088348 TGTAGTCCTCACTACTTTGGAGG + Intronic
1157352413 18:46900553-46900575 TGTAGTCTTGATTACTTAGGAGG + Intronic
1157809429 18:50684153-50684175 TAATGTTTTCATTCCTTTGGAGG + Intronic
1159887585 18:73923704-73923726 TGCAGTCCTGAGTACTTTGGTGG - Intergenic
1159967760 18:74612687-74612709 TGCAATCTTCATTCATTTAATGG - Intronic
1160669279 19:349323-349345 TTCAGTGTTCCTCCCTTTGGAGG - Intergenic
1162793227 19:13073676-13073698 TCCAGTCTCCATTGCTTTGGAGG + Intronic
1163156140 19:15440755-15440777 TGCAGTTTTCCTTCCTAGGGTGG + Intronic
1166251540 19:41574843-41574865 TTCTGTGTTCATTTCTTTGGGGG - Intronic
1167877469 19:52426274-52426296 TGTAATCTTCATACATTTGGTGG - Intergenic
925373727 2:3366407-3366429 TGCAGACTTCCTTCCTGTGCTGG - Intronic
926684099 2:15685236-15685258 GGAAGTCTCCATTCATTTGGTGG - Intergenic
928318136 2:30261651-30261673 TGCAGTTTTCATTGTTTTGGAGG - Intronic
931318975 2:61157982-61158004 TGCAGACTTCTTTGCTATGGTGG - Intronic
931539218 2:63310735-63310757 TGTAGTCTTAGCTCCTTTGGAGG + Intronic
931998523 2:67862214-67862236 TTGAGTCTTCATTACTTTGTAGG + Intergenic
935858528 2:107301811-107301833 TTGAGTCTTCATTTCTTTAGAGG + Intergenic
936486637 2:112931419-112931441 TGCTGTCTTGATTCCCTGGGTGG + Intergenic
937831970 2:126434147-126434169 ATCAGTGTTCATTCCTTGGGCGG + Intergenic
943024998 2:182616956-182616978 TCCAGTCATATTTCCTTTGGAGG - Intergenic
943204580 2:184876880-184876902 TGCATTCTTTTTTCTTTTGGTGG - Intronic
945064544 2:205937710-205937732 AGCAGTCTTAAATCCTTTTGGGG + Intergenic
946121936 2:217523663-217523685 TTCAGTCTGAATCCCTTTGGTGG + Intronic
1170317777 20:15061336-15061358 TGGAGTGTTCATGCCCTTGGTGG + Intronic
1171280440 20:23891763-23891785 TGAAGTCTTCACTGCTTTGCTGG + Intergenic
1173228672 20:41177312-41177334 GGCAGTCTTTAGTCCTGTGGCGG - Intronic
1173303751 20:41828567-41828589 GGCAGTATTCTTTCATTTGGGGG - Intergenic
1173396029 20:42680640-42680662 TGCAGACTTCAATAGTTTGGAGG + Intronic
1174528153 20:51190080-51190102 TGGAGTCTGAATTCCCTTGGTGG + Intergenic
1175681187 20:60990006-60990028 TGCATTCTTCCTTCCCTTTGGGG + Intergenic
1177391197 21:20475219-20475241 TACAGTTTTCACTTCTTTGGGGG + Intergenic
1185295625 22:50052363-50052385 CGCTGTTTTTATTCCTTTGGTGG - Intronic
949875826 3:8625439-8625461 TGCAGGCTGCATTCCTTGGAAGG - Intronic
950733803 3:14988296-14988318 TGCAGTCCTGCTTCCCTTGGAGG - Intronic
951332897 3:21387250-21387272 CGCAGTCCTCAGTCCTTGGGCGG + Intergenic
953060228 3:39421830-39421852 TGGAGCCTGCATTGCTTTGGAGG + Intergenic
953096334 3:39780099-39780121 TGCACTCCTCAGTCCTTGGGTGG - Intergenic
955785399 3:62532764-62532786 GCCTGTCTTCATTCCTTCGGTGG - Intronic
955896526 3:63706484-63706506 TGCATTCTTCATTCCATTACTGG - Intergenic
960321487 3:116242133-116242155 TTTACTCTTCATTCTTTTGGTGG - Intronic
960520801 3:118653074-118653096 TGCACTCTTCCTTTCTTTGTGGG - Intergenic
960814073 3:121655586-121655608 TGCACACTTCATGCCTTTGGTGG - Intronic
962490616 3:135890598-135890620 TGCAGTCTTCAGTTCATTGACGG + Intergenic
962651814 3:137502253-137502275 TTCAGTCTTCATTTCTCTGAAGG + Intergenic
966106695 3:176344092-176344114 TGTAGTCTTTATTACTTAGGAGG - Intergenic
966418891 3:179718182-179718204 TTGAGTCTTCATTCCTTTTAAGG + Intronic
966543399 3:181117007-181117029 TAAAGTCTTCATTCTTTTGTAGG + Intergenic
967448564 3:189596486-189596508 TGCACTCTTCAGCCCTTGGGTGG - Intergenic
967594856 3:191317011-191317033 TGCACTCCTCATCCCTTGGGCGG + Intronic
968132464 3:196199479-196199501 TGGAGTCCTGGTTCCTTTGGTGG - Intronic
969618795 4:8268651-8268673 TCCAGCATTCATTCCTTTGGGGG + Intergenic
970608002 4:17699740-17699762 TGCAGTCTTCATTCCTTTGGTGG - Intronic
972059129 4:34846336-34846358 TGGAGTCTACATTCCAGTGGAGG + Intergenic
972658123 4:41086274-41086296 TTCCTTCTTCATTTCTTTGGAGG - Intronic
973124239 4:46564508-46564530 TGCAGTCCCCACTCCTTGGGAGG - Intergenic
974239078 4:59221104-59221126 TAAAGTATTCATTCCTTTAGTGG - Intergenic
975082533 4:70298379-70298401 TGTAGTCTTTATACCTTTTGTGG - Intergenic
975315713 4:72950840-72950862 TGAGGTCTTCATTTCTTTGCTGG + Intergenic
977416716 4:96742881-96742903 TGCACTCTTCAGCCCTTGGGAGG - Intergenic
977750903 4:100608763-100608785 TGCATTCTTCAGCCCTTGGGTGG + Intronic
978229609 4:106383272-106383294 TTCAGTTTTCTTTCCTTTGTAGG + Intergenic
980801820 4:137761447-137761469 AGCAGTATTCAATCATTTGGTGG + Intergenic
981136260 4:141213909-141213931 TGCACTCTTCAGCCCTTGGGCGG - Intergenic
981275037 4:142889251-142889273 TGCAGTCTTAACTACTTGGGAGG - Intergenic
981575524 4:146200542-146200564 TCCAGTCTTCTTTATTTTGGTGG - Intergenic
983130915 4:164019107-164019129 GGCACTCTTCATTCCTTTGCTGG - Intronic
986415477 5:7523881-7523903 TGCACTCTTCCTTCCTTTGGTGG - Intronic
986743435 5:10724199-10724221 GGCCATCTGCATTCCTTTGGTGG - Intronic
987759810 5:22147304-22147326 TGCATTCTTGTTCCCTTTGGAGG + Intronic
988525245 5:31981584-31981606 TGCAGTCATCATTTCTTCAGAGG + Intronic
989389007 5:40881162-40881184 TGCAGTCCTAGTTCCTTGGGAGG + Intergenic
991479478 5:67061869-67061891 TACAGACTTCCTTCCTTTGTAGG - Intronic
991591302 5:68254423-68254445 TGGATCATTCATTCCTTTGGGGG - Intronic
991894540 5:71380732-71380754 TGCATTCTTGTTCCCTTTGGAGG + Intergenic
992366261 5:76093235-76093257 TCCTGACTTCAGTCCTTTGGAGG + Intronic
992488729 5:77220277-77220299 TGGAGCCTTCATCCCTTGGGAGG + Intronic
995054271 5:107742165-107742187 TGAAGTCTTAACTGCTTTGGGGG + Intergenic
996805716 5:127452148-127452170 TTCTGTCTTCATTGCCTTGGAGG - Intronic
1000084807 5:157879640-157879662 TGCACTCTTCAGCCCTTGGGTGG - Intergenic
1000167350 5:158665756-158665778 TTCAGTCTTCATTCTTTTTAGGG + Intergenic
1003615582 6:7652531-7652553 AGGAGTCTTAGTTCCTTTGGTGG - Intergenic
1003824986 6:9942556-9942578 TGCAGTCCTCAGCCCTTGGGCGG - Intronic
1006066396 6:31465314-31465336 TGCAGTGTCCTTTCCTGTGGAGG + Intergenic
1006128013 6:31852378-31852400 TGCACTCTTCAGCCCTTGGGAGG - Intergenic
1006622727 6:35377728-35377750 TGCACTGTTTATTCCTTTGCTGG + Intronic
1006724094 6:36183866-36183888 TGTAGTCTTAATTACTTGGGAGG + Intergenic
1007962367 6:45971485-45971507 AGCAGGCTTCCTTCCTTAGGTGG - Intronic
1008366924 6:50691848-50691870 TGCCTTCCTCATTCCTTTGGTGG - Intergenic
1008389341 6:50931625-50931647 TGTAGTCCTCACTACTTTGGAGG - Intergenic
1008443636 6:51561811-51561833 TGCACTTTTCCTTCCTTTGATGG + Intergenic
1010654254 6:78493451-78493473 TGCAGTTTTCTTTATTTTGGTGG + Intergenic
1011187604 6:84696308-84696330 TTCATCCTTCATTCCATTGGAGG + Intronic
1013710761 6:112895178-112895200 GGCATTCTTAATTCCTGTGGGGG + Intergenic
1014838034 6:126182682-126182704 TGCAGCCTTCATTCCTGTGCAGG + Intergenic
1014896075 6:126900736-126900758 TGCTGTCTTCATTGGTTTTGGGG + Intergenic
1017423811 6:154300006-154300028 TGAAGTCTTCATTCACTTCGGGG - Intronic
1018801412 6:167225445-167225467 AGTAGTCTTCTTTCTTTTGGAGG + Intergenic
1020558050 7:9693868-9693890 TGCACTCTTCCTTCCCTTAGGGG + Intergenic
1021694193 7:23260420-23260442 TGCATTCTTTATTTCTTTGGGGG + Intronic
1023501055 7:40849855-40849877 TGAAGGCTTCATTCCTTTCAGGG + Intronic
1024608166 7:51039729-51039751 TGCAGCCTTCAGTCCTCAGGAGG + Intronic
1026236881 7:68534984-68535006 TGCACTCTTCAGCCCTTTGGCGG + Intergenic
1027364823 7:77446438-77446460 TGCAGTTTTCACTCATTTAGTGG - Intergenic
1027668809 7:81071469-81071491 TGCACTCCTCAGTCCTTGGGTGG - Intergenic
1029730427 7:102434579-102434601 TTCACCCTTCCTTCCTTTGGAGG + Intronic
1031100044 7:117468871-117468893 TGCAGTCTGCATTCCATTTTAGG + Intronic
1031781405 7:125971292-125971314 TTCAGTCCTCATTCCTTTGTGGG - Intergenic
1031944913 7:127829711-127829733 AGCAGACTTCATTCCTTTTTAGG - Intronic
1032105342 7:129024354-129024376 TTCAGTTTTCATCCATTTGGTGG - Intronic
1032505385 7:132430638-132430660 TGCAGTCTTCATGCCTCTTGAGG + Intronic
1034029670 7:147746629-147746651 TGCCTTATTCTTTCCTTTGGTGG - Intronic
1034369146 7:150579516-150579538 TGAGGGCTGCATTCCTTTGGAGG + Intergenic
1035958313 8:4107934-4107956 TGCAGTTTTCAGTCCGTAGGGGG - Intronic
1036067605 8:5400197-5400219 TGTTGTCTTTATTCCGTTGGGGG - Intergenic
1036417485 8:8564085-8564107 TGCGGTCTTCCTTCCTCTGTAGG + Intergenic
1036624660 8:10458457-10458479 TTCAGTCCTCATTACTTTAGTGG - Intergenic
1036672509 8:10801332-10801354 TGCAGTCATCATTTTCTTGGAGG - Intronic
1037160617 8:15767624-15767646 TGCAGCCTGCATTCCTTATGTGG + Intergenic
1037457785 8:19081318-19081340 TGCACTCCTAATTCCTCTGGTGG - Intronic
1038567392 8:28631271-28631293 GGCACTCTTCTTACCTTTGGTGG + Intronic
1041910929 8:63087364-63087386 AGGAGTTTTCATTCTTTTGGGGG + Intergenic
1042448569 8:68918474-68918496 TTCAGTCCTCATCCATTTGGAGG - Intergenic
1044712876 8:95073737-95073759 TGCTGACTGCATTCCTTGGGTGG - Intronic
1045305989 8:100957182-100957204 TGCACTCCTCAGTCCTTGGGCGG + Intergenic
1045529363 8:102970007-102970029 GGCACTCTGCATTCCTTTAGGGG + Intronic
1048769871 8:137883813-137883835 TGTTTTCTTCATTCCTTTGCAGG - Intergenic
1052150545 9:25109547-25109569 TGGACTATCCATTCCTTTGGGGG + Intergenic
1052768148 9:32662340-32662362 TGGAGTCTTCAAGCATTTGGGGG - Intergenic
1052840820 9:33289736-33289758 CGCAGTCTTTTTTTCTTTGGTGG - Intergenic
1055434343 9:76277272-76277294 TGAAGCCTTCATTCTTTGGGGGG - Intronic
1056911214 9:90702582-90702604 TGCAGGCTGCAATCCTTTGTGGG - Intergenic
1057300762 9:93880271-93880293 TGCACTCCTCAGTCCTTGGGTGG - Intergenic
1058799426 9:108530505-108530527 TGCAGTCCTCAGCCCTTGGGTGG - Intergenic
1059043288 9:110837921-110837943 TGAAGTCTTCATTTATTTGGAGG - Intergenic
1059585352 9:115600135-115600157 AGCAATATTCATTCATTTGGTGG + Intergenic
1061441473 9:130606871-130606893 TGCAGTTTTGTTTCTTTTGGAGG + Intronic
1061886695 9:133594667-133594689 TGGAGTTTTCAGTCCTGTGGGGG + Intergenic
1062034382 9:134376388-134376410 TGCTGTCTCCATTCCTTCGCGGG + Intronic
1185919432 X:4073913-4073935 TGGAGTATTCATTCCTTTCTGGG + Intergenic
1186200352 X:7149716-7149738 AGCAGTCTTAATTCCTTCTGAGG + Intergenic
1186933824 X:14424856-14424878 TGCACTCTTCTTCCATTTGGAGG + Intergenic
1188878931 X:35468419-35468441 TGGAGTCTTCACTACTTGGGTGG + Intergenic
1188938423 X:36206456-36206478 TGCCTTATTCTTTCCTTTGGTGG + Intergenic
1189923457 X:45927849-45927871 TCCAGTGTTCATTCCTTTCTGGG + Intergenic
1191678447 X:63816163-63816185 TGCTCCCTTCAGTCCTTTGGAGG + Intergenic
1192205094 X:69090329-69090351 TCTGGTCTTGATTCCTTTGGAGG + Intergenic
1192248916 X:69394988-69395010 TGCAGACTTCTTTGCCTTGGGGG + Intergenic
1193155645 X:78170577-78170599 TGACGGCCTCATTCCTTTGGGGG + Intergenic
1195262018 X:103141810-103141832 TGTGGTCTTCATTGCTTGGGAGG + Intergenic
1196123535 X:112075820-112075842 TGAAGTCCTAATTTCTTTGGTGG - Intronic
1196270033 X:113699483-113699505 TGCAGTCTTCAGTCAGTTTGTGG + Intergenic
1196860803 X:120025767-120025789 TGCACTCCTCATCCCTTGGGCGG + Intergenic
1200330836 X:155295735-155295757 TGCCATCTTCATTTCTTTTGTGG - Intronic
1202100530 Y:21303572-21303594 TGCAGTCCTCAGCCCTTGGGCGG + Intergenic