ID: 970608003

View in Genome Browser
Species Human (GRCh38)
Location 4:17699743-17699765
Sequence TTCTGCAGTCTTCATTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970608003_970608005 -8 Left 970608003 4:17699743-17699765 CCAAAGGAATGAAGACTGCAGAA 0: 1
1: 0
2: 3
3: 37
4: 305
Right 970608005 4:17699758-17699780 CTGCAGAAATGGCAAACAAATGG No data
970608003_970608006 -7 Left 970608003 4:17699743-17699765 CCAAAGGAATGAAGACTGCAGAA 0: 1
1: 0
2: 3
3: 37
4: 305
Right 970608006 4:17699759-17699781 TGCAGAAATGGCAAACAAATGGG 0: 1
1: 0
2: 0
3: 24
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970608003 Original CRISPR TTCTGCAGTCTTCATTCCTT TGG (reversed) Intronic
901899715 1:12349293-12349315 TTCTGCAGTCTTCACTACATTGG - Exonic
902857255 1:19217030-19217052 TTCTCCTGTCTTCATTAATTAGG - Exonic
903262100 1:22136904-22136926 TTCTGCTGTCTCCAGCCCTTGGG + Intronic
905001177 1:34671291-34671313 CTCTGCAGTCTTCACTCTTGGGG + Intergenic
907238830 1:53069574-53069596 TTCTGCAGCCTTCATTCAGCAGG - Intronic
908506623 1:64808795-64808817 ATCTGCAGTGTTCATTGCTTGGG + Intronic
910199263 1:84681811-84681833 TAATGCAGTCTTCATACCTGAGG + Intronic
910713326 1:90204151-90204173 GACTGCAGAATTCATTCCTTTGG - Intergenic
911158700 1:94661117-94661139 TTCTGCATCCTTCAGTCCTGTGG + Intergenic
913021787 1:114795443-114795465 TTCTCCAGTCTTCCCTCTTTAGG - Intergenic
914988853 1:152481188-152481210 TTCTGAAGTTTTCCTACCTTTGG - Intergenic
916369328 1:164073008-164073030 TTTTGCAGTCTTCATTGTCTGGG + Intergenic
916561089 1:165934642-165934664 TTCTGCATCCATCATTCCCTGGG + Intergenic
916735595 1:167604435-167604457 TTCCACAGTCTTCTTTCCTAAGG - Intergenic
918141495 1:181723918-181723940 TTATGGAGTCTTCATTACATAGG + Intronic
918600332 1:186350865-186350887 TTCTTCACTCTTAATTCCTTTGG - Intronic
918862626 1:189851509-189851531 CTCTGCTTTCTTCATTCCTGTGG + Intergenic
919088468 1:192949561-192949583 TACTGCAGCCTCCATTTCTTGGG - Intergenic
919536199 1:198790868-198790890 TTATGGAGTCTTCATTACATAGG + Intergenic
921365474 1:214369752-214369774 TTCTTCTGTCTTCATATCTTAGG - Intronic
922759949 1:228122276-228122298 TTATGGAGGCTTCATTACTTAGG + Intergenic
923371874 1:233322629-233322651 TTCTGCAGACTGGATTCCTCTGG + Intergenic
1064263477 10:13805217-13805239 TGCTGCAGCCTTCAATACTTGGG + Intronic
1067150033 10:43724241-43724263 TTCTACATTGTTCATTTCTTTGG - Intergenic
1067398892 10:45952235-45952257 TTTTGAAGGCTTTATTCCTTGGG - Intergenic
1067515442 10:46936979-46937001 TTTGCCACTCTTCATTCCTTTGG + Intronic
1067646809 10:48114831-48114853 TTTGCCACTCTTCATTCCTTTGG - Intergenic
1067867212 10:49921471-49921493 TTTTGAAGGCTTTATTCCTTGGG - Intronic
1068838350 10:61581146-61581168 TCCTGCAGTGTTCTTTGCTTAGG - Intergenic
1070756587 10:78997185-78997207 TTCTCCAGTCTGCATTACTCTGG + Intergenic
1071691283 10:87821902-87821924 ATCTACAGTCTTCATTCACTAGG - Intronic
1071900944 10:90119825-90119847 TGCTGCACTCCTCATCCCTTGGG + Intergenic
1072372309 10:94776064-94776086 TTCTACAGTTTTTATTGCTTAGG + Intronic
1072387205 10:94942868-94942890 TTCTACAGTTTTTATTGCTTAGG + Intronic
1072535423 10:96359250-96359272 TTCTGCAGCCTGCAGCCCTTTGG + Exonic
1076004774 10:126939763-126939785 TGCTGCTGCTTTCATTCCTTTGG + Intronic
1076562062 10:131373491-131373513 TTCTGCAGGCTGCAGTCCCTTGG + Intergenic
1077538121 11:3134140-3134162 TTCTGCAGCTTCCATTCCTGGGG + Intronic
1079523410 11:21355899-21355921 ATCTGCACACTTCATTCCTTGGG + Intronic
1080466773 11:32504773-32504795 TTCTTCACTATTCATTGCTTGGG + Intergenic
1084502444 11:69542853-69542875 CTCTGCAGTCTGCACTCCTCGGG + Intergenic
1085041450 11:73328729-73328751 TGGTGCAGTCTTCATTCAGTGGG + Intronic
1086665032 11:89469898-89469920 TTCTGAAGTTGTTATTCCTTAGG + Intronic
1087074193 11:94114085-94114107 TTCTCAAGACTTCATTCCCTTGG + Intergenic
1087663724 11:101017904-101017926 AGCTCCAGACTTCATTCCTTTGG + Intergenic
1088282475 11:108149727-108149749 TTCTTAATTCTTCATTCCATGGG - Intergenic
1089247973 11:117136497-117136519 TTCTGCTGTGTTCTTTCCTCAGG + Intergenic
1089258741 11:117208064-117208086 TTCTGCTGTGTTCTTTCCTCAGG - Exonic
1090631458 11:128652755-128652777 TCATGCAGGCTTCATTACTTAGG + Intergenic
1091803174 12:3337816-3337838 CTCTGGAGTCTTAACTCCTTGGG + Intergenic
1095880306 12:47129112-47129134 TTCTGCTTTCTGCCTTCCTTTGG + Intronic
1098988129 12:77034555-77034577 TTCTGCTGACCTTATTCCTTTGG - Intronic
1099735073 12:86556808-86556830 TTCTGCAGTATTCATTCATTAGG - Intronic
1100205382 12:92343160-92343182 CACTGCAGTCTTGAATCCTTGGG + Intergenic
1100625887 12:96331495-96331517 TTCAGGATTCATCATTCCTTGGG + Intronic
1100850406 12:98704290-98704312 TTTCTTAGTCTTCATTCCTTAGG + Intronic
1101960723 12:109247749-109247771 TTCAGCTGTCTTCTTTCCTCGGG + Intronic
1102396653 12:112591657-112591679 TTCTGCACTCTGCATTGTTTTGG + Intronic
1102613794 12:114135259-114135281 TTCTGGAGTCTTCTACCCTTAGG - Intergenic
1106359463 13:29017025-29017047 TTCTGCAGTTATAATTACTTAGG - Intronic
1108131354 13:47304482-47304504 TTCTCCAGTGTTCATACCTTTGG - Intergenic
1108165706 13:47690830-47690852 TTCTGCTTTCTTAATTCCTGGGG - Intergenic
1108577521 13:51802910-51802932 TTTTACAGTCTGCTTTCCTTGGG + Intronic
1109064076 13:57661824-57661846 TACTGCAGTCTTCATTAGTGTGG + Intronic
1109129024 13:58557126-58557148 TTCTTCTGTCTGCATTCTTTGGG + Intergenic
1110047166 13:70844890-70844912 TTCTGCTGCCTTCATCTCTTGGG + Intergenic
1110343231 13:74416439-74416461 TTTAGCAGTATTCATTCCCTTGG - Intergenic
1111555561 13:89876999-89877021 TTTTGAAGTCTACATTCCTGTGG + Intergenic
1112092895 13:96100976-96100998 TGCTGCACTCATCATTCTTTAGG - Intronic
1113450590 13:110406823-110406845 GGCAGCAGTCCTCATTCCTTTGG + Intronic
1115906433 14:38208260-38208282 TTCTGCAGTCGATATTCCTGTGG + Intronic
1117108532 14:52424457-52424479 TAATGCATTCTACATTCCTTGGG - Intergenic
1117684064 14:58235637-58235659 TTTTGCTGGCTTCATTCTTTCGG + Intronic
1118865954 14:69703714-69703736 CTCTGCAGCCTCCCTTCCTTGGG + Intronic
1119459591 14:74789086-74789108 TTCTGGACTCTCCATTCCTGTGG + Intronic
1119460900 14:74802626-74802648 TTCTGCAATCTTGATTCCTGAGG - Exonic
1119707054 14:76789475-76789497 TTCTGCAGGCTGCATCCCCTTGG + Intronic
1120116070 14:80619087-80619109 TTTTTCAGTTTTAATTCCTTAGG - Intronic
1120207332 14:81600692-81600714 TGCTGCAGTCCACATTCCATGGG + Intergenic
1122386557 14:101352191-101352213 TTCTGGTGTCTTAAGTCCTTAGG - Intergenic
1124061263 15:26295605-26295627 TTCTGCTATCTTCATTGCATTGG + Intergenic
1125639678 15:41220036-41220058 TTATTGACTCTTCATTCCTTGGG - Intronic
1128030431 15:64475148-64475170 TTTTTCAGTCTCCATTTCTTAGG + Intronic
1130538896 15:84807282-84807304 TTCTGCAGAATTATTTCCTTGGG + Intergenic
1132122225 15:99185962-99185984 TTTTTCACCCTTCATTCCTTTGG - Intronic
1132809097 16:1789195-1789217 TTCTAGAGTCTTCTGTCCTTCGG + Intronic
1133103152 16:3491270-3491292 TCCTGGAGACTTCAGTCCTTGGG - Intergenic
1133276319 16:4640407-4640429 TTTTGCAGTTTTCATTTCTGTGG + Intronic
1134505567 16:14803255-14803277 GTCTGCAGTCTTCATGGCATTGG + Intronic
1134575013 16:15325656-15325678 GTCTGCAGTCTTCATGGCATTGG - Intergenic
1134727433 16:16430835-16430857 GTCTGCAGTCTTCATGGCATTGG + Intergenic
1134940002 16:18281020-18281042 GTCTGCAGTCTTCATGGCATTGG - Intergenic
1135235524 16:20751752-20751774 TTCTCCATTCTTCTTCCCTTGGG + Intronic
1137681994 16:50356690-50356712 GTCTGCCCTCTTCTTTCCTTAGG + Intronic
1138851967 16:60640591-60640613 CTATGAAATCTTCATTCCTTTGG + Intergenic
1139243585 16:65419262-65419284 TCCTGGAGTCTCCTTTCCTTGGG - Intergenic
1140389392 16:74572194-74572216 TTATGGAGTCTTCATTACTTAGG - Intronic
1140648792 16:77064599-77064621 CCCTGCAGTCTTCCTTCCTTAGG - Intergenic
1140810514 16:78572730-78572752 TTTTGCATTCTTCATTCCCTTGG - Intronic
1143343729 17:6234116-6234138 TTCTGCAGTCATCATTTATCTGG + Intergenic
1143593983 17:7903181-7903203 TTCAGCAGCCTTCTTTCCTGAGG + Intronic
1144001419 17:11058588-11058610 TTCTGCAGTATAGATTCTTTTGG - Intergenic
1149081822 17:52666935-52666957 TTCAGTAGTCTTCATTTCTTTGG - Intergenic
1149170094 17:53799414-53799436 TTCTGCAGGCTTTATTACTTAGG - Intergenic
1149650805 17:58275306-58275328 CCCTGCAGTCTTCTTTCCTGTGG - Intronic
1150001154 17:61441115-61441137 TTCTTCAGTCTTCATTCCCCAGG - Intergenic
1150240318 17:63626405-63626427 TTCTATAGTCTCCAGTCCTTTGG + Intronic
1151421072 17:73998290-73998312 TTCCTCTGTCTTCATTCCTGGGG - Intergenic
1151711322 17:75808661-75808683 TTCTGCAGTCTCCAAGCCTCTGG + Intronic
1154097542 18:11432277-11432299 ACCTGCACTCTTCAGTCCTTGGG + Intergenic
1154198420 18:12282540-12282562 TTCTGGAGCCTTCATTACATAGG - Intergenic
1155067711 18:22282281-22282303 TTCTTCAGGCTTCATTGTTTTGG - Intergenic
1155769828 18:29682652-29682674 TTCTGCATCCTTGATTCCTTTGG - Intergenic
1156040770 18:32819714-32819736 TTCTGGACTCTTTATTCCATCGG - Intergenic
1156087982 18:33431148-33431170 TTATGTAGACTTCATTCTTTTGG - Intronic
1158610740 18:58938184-58938206 GTCTGCAGTCTTCCTTCCCTGGG + Intronic
1159071518 18:63627793-63627815 TTCTTCCATCTTCATTTCTTTGG - Intergenic
1160116982 18:76088132-76088154 TTGTGCAGTGTTCAATCATTAGG - Intergenic
1161843332 19:6695397-6695419 TTCTCCAGTCTTCCCTCCTGGGG + Intronic
1162793226 19:13073673-13073695 GTCTCCAGTCTCCATTGCTTTGG + Intronic
1165637268 19:37351450-37351472 TTCTGCATTCTACTTTCTTTGGG + Intronic
1166911397 19:46160772-46160794 CTCTGCTGTCTTGATTCCTTTGG + Exonic
1167861129 19:52284941-52284963 TTATGGAGGCTTCATTACTTAGG + Intronic
925055288 2:852560-852582 TTCTGCTGACTTCACTCTTTAGG - Intergenic
925651674 2:6096903-6096925 ATATGGAGTTTTCATTCCTTAGG - Intergenic
925657861 2:6168797-6168819 TTCTGGGGTCTTCACTTCTTAGG + Intergenic
925700840 2:6636193-6636215 TCCTGTGGCCTTCATTCCTTGGG - Intergenic
926633346 2:15157329-15157351 TTCTGCATTCTTCATTCAATGGG - Intergenic
927974616 2:27328806-27328828 TTTTGCAGTCTTCATTACAAAGG - Intronic
928318137 2:30261654-30261676 TTTTGCAGTTTTCATTGTTTTGG - Intronic
928712161 2:34019275-34019297 GCCTGCAGTGTTCATGCCTTTGG + Intergenic
928800490 2:35083895-35083917 TTCTGCATTCTCTATTCCATTGG - Intergenic
929249316 2:39735353-39735375 TTCTGTAGTCCTTATTCCTTGGG - Intergenic
929390896 2:41467217-41467239 TTCTGCAGCCTTCATTACAGAGG - Intergenic
930750512 2:54930066-54930088 ACCTGAAGTATTCATTCCTTTGG + Intronic
930817692 2:55616589-55616611 ATCTGTAGTCTGCATTTCTTCGG - Intronic
932551854 2:72778731-72778753 TTCTAAAGACTTCACTCCTTTGG + Intronic
933247328 2:79990209-79990231 TTCTGCAGTCATTGTTCCCTGGG - Intronic
937270330 2:120646250-120646272 TCCTTCTGTCTTCTTTCCTTGGG + Intergenic
937395801 2:121533531-121533553 TTCTGCTTTCTTCAGCCCTTAGG + Intronic
940513679 2:154651631-154651653 TTTTGTAGTTTTCATTCCTTGGG + Intergenic
940709968 2:157150437-157150459 TTCTCCAGTCTTCAGTCCTTAGG + Intergenic
941225770 2:162846238-162846260 TTTTGTGGTCTTCATTGCTTTGG - Intergenic
944618678 2:201489060-201489082 CTCTTCTGTCTTGATTCCTTTGG + Intronic
945040681 2:205741483-205741505 TTCTCCAATCTACATGCCTTGGG - Intronic
945686145 2:212972676-212972698 TTCCTCAGGCTTCATTCTTTTGG - Intergenic
946387513 2:219393834-219393856 TTCTGCTGTCCTCATTTCTGTGG + Intronic
946494402 2:220181362-220181384 TTCTGCCTTATTTATTCCTTGGG - Intergenic
946956522 2:224936022-224936044 CTCTGGAGTCTTCACTCATTGGG - Intronic
947602235 2:231460811-231460833 TTTTGCAGCTTTCTTTCCTTTGG + Exonic
1168992534 20:2106813-2106835 TTCTGCTGTCTTAATGCCTCTGG - Intronic
1169958960 20:11137520-11137542 TTCTACAGCCTTGATGCCTTTGG + Intergenic
1170362564 20:15562641-15562663 TTCTGAAGTCTTTAATCATTGGG + Intronic
1170786817 20:19474335-19474357 TTGTGCAGTCTTCTTGCATTGGG - Intronic
1170831352 20:19844461-19844483 CCCTGCAGTAGTCATTCCTTTGG - Intergenic
1173440654 20:43072316-43072338 ATCTGCAGGCTTCAGGCCTTAGG - Intronic
1173778633 20:45734979-45735001 TTCTGCACTCTTTATTCTATTGG - Intergenic
1176332028 21:5558139-5558161 TTCAACAGTCTTCATCCCTATGG + Intergenic
1176395729 21:6262812-6262834 TTCAACAGTCTTCATCCCTATGG - Intergenic
1176441428 21:6726292-6726314 TTCAACAGTCTTCATCCCTATGG + Intergenic
1176465690 21:7053361-7053383 TTCAACAGTCTTCATCCCTATGG + Intronic
1176489251 21:7435139-7435161 TTCAACAGTCTTCATCCCTATGG + Intergenic
1177037894 21:16067546-16067568 TTGTGCAGACTTCACTCTTTTGG + Intergenic
1177167012 21:17613608-17613630 CTCTCAAGGCTTCATTCCTTTGG - Intergenic
1178474222 21:32922302-32922324 TTCTGTTCTCTTCATTCCGTAGG - Intergenic
1180070383 21:45432875-45432897 TTCTGCAGCCTTGATTTCTGTGG - Intronic
1182796612 22:32995625-32995647 CCCTGCAGTCCTCATGCCTTCGG + Intronic
1183082006 22:35462733-35462755 TTCTGACGTCTTCCTTCCTCGGG + Intergenic
951369255 3:21825567-21825589 CTCTGCATTCTTCATTTCATTGG + Intronic
951783622 3:26392647-26392669 CTCTGAAGTTTTCTTTCCTTTGG + Intergenic
952858137 3:37790156-37790178 TTCAGCAATCTGAATTCCTTTGG + Intronic
955301128 3:57780717-57780739 CACTGCAGTCTTGATTTCTTGGG + Intronic
955985251 3:64567085-64567107 TCCTCCAGTCATCATTCCTCAGG - Intronic
956461069 3:69473102-69473124 TCCTCCAACCTTCATTCCTTTGG - Intronic
956525298 3:70153009-70153031 GTATGCAGTCGTCATTCCATTGG + Intergenic
956804399 3:72794776-72794798 AGCTCCAGTCTTCATTCCTTCGG + Intronic
960574060 3:119212177-119212199 TTCAGCAGTCTTATTTCCTGTGG + Exonic
961777501 3:129299306-129299328 TTTTGCAGTCTTAAATCCTGGGG + Intronic
962131088 3:132677544-132677566 CTCTTAAGTCTTCATTACTTGGG - Exonic
963349980 3:144139988-144140010 CTCAGCAGGCTTCCTTCCTTAGG - Intergenic
964459190 3:156903821-156903843 TTCTGTAGGATTCTTTCCTTGGG - Intronic
964775694 3:160274227-160274249 CTCTCCACTCTACATTCCTTAGG - Intronic
965754833 3:172015152-172015174 TTATGCAAGCTTCATTACTTAGG - Intergenic
965939345 3:174158854-174158876 TCCAACAGTCTGCATTCCTTAGG + Intronic
966026606 3:175291668-175291690 TTCAGGAGTCTTCATTCCTTGGG - Intronic
966030670 3:175343541-175343563 TTCTACAATCTGCATTTCTTTGG + Intronic
967050663 3:185781121-185781143 TTTTGCAGCCTTATTTCCTTGGG - Intronic
967600642 3:191383987-191384009 TTCTGCAGTCTTCAGATCCTTGG + Intronic
967780953 3:193438757-193438779 TTCTGGAGTTCTCATTTCTTTGG - Intronic
968126786 3:196165970-196165992 TGCTGCAGTCTTATTTCCATGGG - Intergenic
968260494 3:197319348-197319370 TTCAGAACTCTTCATTCCTTAGG + Intergenic
970428685 4:15968039-15968061 ATCTGAAGTCATCATTTCTTAGG - Intronic
970528489 4:16957254-16957276 TTGTGCAGTATTAATTCATTTGG + Intergenic
970608003 4:17699743-17699765 TTCTGCAGTCTTCATTCCTTTGG - Intronic
971899989 4:32646838-32646860 TTCTGCACTTTTCCTACCTTTGG - Intergenic
972213599 4:36869004-36869026 ATCTGCAATCTTCCTTCCTTAGG - Intergenic
972303660 4:37810980-37811002 TTGTGTATTCTTCATTCCTATGG + Intergenic
972463545 4:39329663-39329685 TACTGCAGCCTCCATTTCTTGGG - Intronic
973098264 4:46228665-46228687 TTCTGTATTCTCCTTTCCTTTGG - Intergenic
974211086 4:58777498-58777520 TTCTGCAATTTTCATTTTTTTGG + Intergenic
974553197 4:63407414-63407436 TTCTGGAATCTTCATTCTTTTGG - Intergenic
974662674 4:64914026-64914048 TTCTACTGTTTTCATTACTTTGG - Intergenic
975903002 4:79175394-79175416 TTCTGCATTTGTGATTCCTTAGG - Intergenic
976254291 4:83084074-83084096 ATCTGCAGTCTTCATGGCCTGGG + Intergenic
977190408 4:93993150-93993172 ATCAGCAGTCTTCAATCCGTAGG - Intergenic
978104767 4:104888395-104888417 CTCTGAATTCTTCCTTCCTTAGG - Intergenic
978207923 4:106102241-106102263 TTCTGTATTCTCCATTCCCTTGG + Intronic
980598037 4:134981431-134981453 TTCTCCCGTCTTCCTCCCTTTGG - Intergenic
981270653 4:142845259-142845281 TTCTGAATTCTCCCTTCCTTGGG - Intronic
981327010 4:143461401-143461423 CTCTCCAGTCTGCTTTCCTTGGG + Intronic
983648788 4:170018541-170018563 TTCTGATGTCTTCTTGCCTTTGG - Intronic
984951772 4:185013202-185013224 TACTGCAGTCTTGAACCCTTGGG - Intergenic
985212597 4:187611352-187611374 TTTTGCAATATTCTTTCCTTAGG - Intergenic
986062036 5:4201056-4201078 TTATGGAGGCTTCATTCCATAGG - Intergenic
987964544 5:24854732-24854754 TCTTGCAGTCTTCTGTCCTTGGG - Intergenic
987975848 5:25014058-25014080 TTCTGGAGTTTTTATACCTTTGG - Intergenic
989547449 5:42691017-42691039 TTATCAAGGCTTCATTCCTTTGG - Intronic
989596547 5:43161302-43161324 TTCTGCAATCTTCCTTTTTTTGG - Exonic
991716687 5:69457444-69457466 TTCTGCAGTTTTCATCCCCTTGG - Intergenic
991731102 5:69589046-69589068 TTCTGCAGTTTTCATCCCCTTGG - Intronic
991807534 5:70444205-70444227 TTCTGCAGTTTTCATCCCCTTGG - Intergenic
991863848 5:71038806-71038828 TTCTGCAGTTTTCATCCCCTTGG + Intronic
991942843 5:71870149-71870171 TTCTTCCTTCTGCATTCCTTGGG - Intergenic
992267007 5:75029378-75029400 TTCTGAAGTCTTCAATCCAGTGG - Exonic
992762046 5:79959092-79959114 TGCTGTAGTGTTCATTCCTTGGG - Intergenic
992778698 5:80109487-80109509 TTCTGCATTTTTAATACCTTGGG + Intergenic
994115333 5:96055472-96055494 ATTTGCATTCATCATTCCTTTGG - Intergenic
994258397 5:97628188-97628210 TTCTGCAGCCTTCATTCATCTGG + Intergenic
994321740 5:98402635-98402657 TTCTGTAATCTTCGTTTCTTTGG + Intergenic
995054268 5:107742162-107742184 TTCTGAAGTCTTAACTGCTTTGG + Intergenic
995538843 5:113164780-113164802 GTCTGCAGTCTTGAGTCCTCAGG - Intronic
996825082 5:127673821-127673843 TTCTATATTCTTCATTCCCTTGG + Intergenic
999042136 5:148426303-148426325 TTGTGCAGTCATTTTTCCTTGGG + Intronic
999495742 5:152095153-152095175 TTCTGGAGTGGCCATTCCTTGGG + Intergenic
999848563 5:155512486-155512508 TTCTGCATACTTGATTCATTAGG - Intergenic
1000437153 5:161226278-161226300 TTTTATTGTCTTCATTCCTTTGG + Intergenic
1001351609 5:170973032-170973054 TGCTGCTGTCTTTTTTCCTTTGG + Intronic
1002340745 5:178515304-178515326 TTCTGCAGTCTGCCTTCCCCAGG + Intronic
1003405936 6:5827414-5827436 TTCTGCAGTCTTCATTTATCTGG - Intergenic
1003706313 6:8535227-8535249 TTTTGAAGTTTCCATTCCTTTGG - Intergenic
1003824987 6:9942559-9942581 GTCTGCAGTCCTCAGCCCTTGGG - Intronic
1003882013 6:10487790-10487812 TTCTGCACTCCTCAGCCCTTGGG + Intergenic
1004256149 6:14066358-14066380 TTGTTCATTATTCATTCCTTTGG - Intergenic
1004578678 6:16925797-16925819 ATCTTCAGACTTCATCCCTTTGG + Intergenic
1005118824 6:22368324-22368346 TTCTGAATTTTTCATACCTTGGG - Intergenic
1006094661 6:31648536-31648558 CTCTGCAGTATTCATTCTTTTGG - Intronic
1006476017 6:34254592-34254614 TTCAGTATTCTTCATTCCTTTGG - Intergenic
1006771917 6:36560886-36560908 TTCTGCCTTCTTCAGTTCTTTGG + Intergenic
1006891622 6:37433683-37433705 CTCTGCAGTCTTCTCTCCCTGGG - Intronic
1008873242 6:56297908-56297930 TTCTGCACTGTTCATTCTTTTGG + Intronic
1009527183 6:64762328-64762350 TTCTGCACTATTCACTCATTAGG + Intronic
1010100596 6:72102180-72102202 TCCTGCAAACTTAATTCCTTTGG + Intronic
1010175000 6:73017825-73017847 TTCTGCAGTGTTCTTTCATGAGG - Intronic
1010597658 6:77784559-77784581 TTCTTCAGTATTAATTCCCTTGG - Intronic
1011562160 6:88631372-88631394 TTCTGCAGTCTCAACCCCTTTGG - Intronic
1012242627 6:96891342-96891364 TTCGGCAATCTGAATTCCTTCGG + Exonic
1012388685 6:98711208-98711230 GGCTCCAGTCTTCATTGCTTTGG + Intergenic
1012526858 6:100188123-100188145 TTCTGAAGGCTTCATTTCCTAGG - Intergenic
1012588994 6:100956270-100956292 TTCTGCAGTCCTCAGTCCCTGGG - Intergenic
1013690685 6:112638698-112638720 TTCTGGAGACTTCATTGATTTGG - Intergenic
1014069339 6:117162756-117162778 TTCAGCTGTCTTCCTTCTTTGGG - Intergenic
1016642293 6:146362763-146362785 TTAAGCAGTCTTCTTTTCTTAGG - Intronic
1016884374 6:148945743-148945765 TTTTGCAGTCTTCATTGTTCAGG + Intronic
1017309916 6:152963335-152963357 TTCTGGTATCTTCATTCCTTTGG - Intergenic
1018751182 6:166807787-166807809 TTCCTCAGTCTTCATTCGTAAGG + Intronic
1018772977 6:166988521-166988543 GTCTGCATTCTTCATTTCTGTGG - Intergenic
1019352921 7:563344-563366 CTCTGCAGACACCATTCCTTAGG + Intronic
1019810487 7:3161783-3161805 TTCTGGAGTCTTTATTTTTTTGG - Intronic
1019878249 7:3834985-3835007 TTCTCCAGCCTTTAGTCCTTTGG + Intronic
1020174918 7:5874310-5874332 TTCAGTAGTCTTCATTATTTTGG - Intergenic
1020698464 7:11446629-11446651 TTCGACAGTCTTCATTACATAGG + Intronic
1023131661 7:37009534-37009556 TTCTGCAGCCCGCCTTCCTTGGG - Intronic
1024614136 7:51093816-51093838 TCCTGCAGCCTTCAATCCCTGGG - Intronic
1024834358 7:53498707-53498729 TTCTGTAGTTTTCATTTATTTGG + Intergenic
1025221015 7:57107636-57107658 TTCTGTCGTCCTCATGCCTTTGG - Intergenic
1026032997 7:66811101-66811123 ATATGCGGTCTTAATTCCTTTGG + Exonic
1026176756 7:68004850-68004872 TACTGCAGTCTCCAATTCTTGGG + Intergenic
1026688023 7:72529199-72529221 TAATTCAGTCCTCATTCCTTGGG - Intergenic
1026723247 7:72851048-72851070 TAATTCAGTCCTCATTCCTTGGG - Intergenic
1026736602 7:72953033-72953055 TTTTGCATTCTTCCCTCCTTAGG - Intergenic
1027107132 7:75412030-75412052 TTTTGCATTCTTCCCTCCTTAGG + Intergenic
1027668811 7:81071472-81071494 TCCTGCACTCCTCAGTCCTTGGG - Intergenic
1029083859 7:97996337-97996359 TTCAGTAGTCTTCATTATTTTGG + Intergenic
1031205975 7:118758027-118758049 TTCTACAGCCTGCATTCCATGGG + Intergenic
1031518619 7:122734796-122734818 TTATGGAGTCTGCATTCCTGGGG - Intronic
1032643944 7:133800219-133800241 TTATCCAGTTGTCATTCCTTTGG + Intronic
1033873529 7:145786379-145786401 TACTGCGGTTTTCTTTCCTTAGG - Intergenic
1034164443 7:149014650-149014672 TTCTGCCATCTTCTTTCCTTTGG + Intronic
1034641809 7:152610048-152610070 TTCTAATGTTTTCATTCCTTTGG - Intergenic
1035308705 7:157951666-157951688 TTCCGCAGTCTTCAGGCCTCAGG + Intronic
1035958316 8:4107937-4107959 TACTGCAGTTTTCAGTCCGTAGG - Intronic
1036961644 8:13250585-13250607 TTATTCAGTCTTTATTGCTTTGG - Intronic
1037000340 8:13709550-13709572 TTCTGGAGTCTCTATTCCATTGG + Intergenic
1037061078 8:14510082-14510104 TTCTGCCTTCTTCATTGCATTGG - Intronic
1038055405 8:23853232-23853254 ATCTGCAGCCTTCATGCCATAGG + Intronic
1038497990 8:28019470-28019492 TTCTGCTGGCTTCATTCCAGGGG + Intergenic
1039039613 8:33395029-33395051 CTCTGCAAACTTCATTCCTCAGG + Intronic
1039991567 8:42492407-42492429 CTCTGCAGTATTACTTCCTTAGG - Intronic
1040424226 8:47268839-47268861 TTCTGAAGTGTGGATTCCTTAGG + Intronic
1041232809 8:55770596-55770618 TACTGCAGTCTTCACTCCACGGG - Intronic
1042063730 8:64849930-64849952 TTCTGCTTTCTTGATTGCTTAGG + Intergenic
1042365209 8:67928533-67928555 GTCTGCAGGTTGCATTCCTTTGG + Intergenic
1043146120 8:76657160-76657182 TACTGCAGTTTTCATTAATTTGG - Intergenic
1043506655 8:80909487-80909509 TTCTCCTGTCTTCTTTGCTTAGG - Intergenic
1045109269 8:98924587-98924609 GTCTGTAGTGATCATTCCTTGGG - Intronic
1046311759 8:112446583-112446605 TTCTGAAGCCTTCATGCCATAGG - Intronic
1048057631 8:130883472-130883494 TTTTGGAGTCTGCAATCCTTAGG + Intronic
1048613260 8:136047295-136047317 TTCTGCAGACTTCATATATTTGG + Intergenic
1048810963 8:138285779-138285801 TTCTGCAGTATTGATGGCTTTGG - Intronic
1050022825 9:1302709-1302731 GTCTGCAGTCTGCATTTCTCTGG - Intergenic
1050061957 9:1718771-1718793 GTCTGCAGGTGTCATTCCTTAGG - Intergenic
1050192968 9:3048248-3048270 TTCTTCATTCTACATTCTTTGGG - Intergenic
1050224103 9:3431428-3431450 TTATGCTGTGTTCATGCCTTTGG - Intronic
1051402923 9:16702673-16702695 TTCTCCAGTTTTTATCCCTTGGG - Intronic
1052212620 9:25924497-25924519 TTCTTCATTCTTAATTTCTTTGG - Intergenic
1055434346 9:76277275-76277297 TTCTGAAGCCTTCATTCTTTGGG - Intronic
1056333588 9:85543105-85543127 TTAAGCAGTCTTCACTCTTTGGG + Intergenic
1057541133 9:95972045-95972067 TTTGGCAGTCTTTATTCCTGTGG - Intronic
1058297490 9:103327207-103327229 TTCTTCATTATTCCTTCCTTAGG - Intergenic
1058302280 9:103390876-103390898 TTCTGCATTCTTCCTTAGTTGGG + Intergenic
1058336841 9:103839904-103839926 TTATGAAGTCTTGATTCATTCGG + Intergenic
1058799427 9:108530508-108530530 GTCTGCAGTCCTCAGCCCTTGGG - Intergenic
1059157740 9:112004877-112004899 TTTTTCAGTCTGCTTTCCTTTGG - Intergenic
1060908848 9:127332818-127332840 TTCTGCAGTTTTCCTTTCCTTGG + Intronic
1062697284 9:137881863-137881885 ATCAGCTGTCTTCATTCCTTTGG + Intronic
1203430070 Un_GL000195v1:82194-82216 TTCAACAGTCTTCATCCCTATGG - Intergenic
1186907910 X:14131525-14131547 TTCTCCATTCTCCAATCCTTGGG + Intergenic
1187250440 X:17593401-17593423 TTTTGGAGTCACCATTCCTTTGG + Intronic
1187767730 X:22661791-22661813 TTCTTCAGCCTTCATTCCAAAGG - Intergenic
1189130013 X:38488652-38488674 TTCTGCAGTCTTCCTGGCCTTGG + Intronic
1189202334 X:39207622-39207644 CACTTCAGACTTCATTCCTTTGG + Intergenic
1189520597 X:41763276-41763298 TACTGTTCTCTTCATTCCTTAGG - Intronic
1189685353 X:43558264-43558286 TGCTTCAGTTTTCATTTCTTTGG - Intergenic
1190884124 X:54516037-54516059 TTCTAAAGTGTTCCTTCCTTAGG - Intergenic
1195318687 X:103703383-103703405 TTCTGCTGTCTTCTTAGCTTTGG + Intergenic
1195611744 X:106874555-106874577 TTCTACAGTCTTCCTACCTGAGG + Exonic
1195891961 X:109705289-109705311 CTCTGCAGTGTACATTTCTTAGG + Intronic
1196236209 X:113283722-113283744 ATTTTCAGTCATCATTCCTTTGG + Intergenic
1197258533 X:124290998-124291020 TTCTGCAAACTACAGTCCTTAGG + Intronic
1197618102 X:128716853-128716875 ATCTGCAGACTTTATTGCTTTGG + Intergenic
1197842030 X:130758582-130758604 GTATGAAGTCTTCATTTCTTTGG + Intronic
1198000441 X:132429807-132429829 TTATTCAGTCTTCTTTCCTGTGG - Intronic
1198721972 X:139632440-139632462 TTCTACAGGCTTCCTTCCCTGGG - Exonic
1198959947 X:142173638-142173660 TGCTGGACTCTTCATTCATTGGG + Intergenic
1201471032 Y:14335225-14335247 TTATGCAGGCTTCATTACATAGG + Intergenic
1202100529 Y:21303569-21303591 ATCTGCAGTCCTCAGCCCTTGGG + Intergenic