ID: 970608005

View in Genome Browser
Species Human (GRCh38)
Location 4:17699758-17699780
Sequence CTGCAGAAATGGCAAACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970608003_970608005 -8 Left 970608003 4:17699743-17699765 CCAAAGGAATGAAGACTGCAGAA 0: 1
1: 0
2: 3
3: 37
4: 305
Right 970608005 4:17699758-17699780 CTGCAGAAATGGCAAACAAATGG No data
970608002_970608005 -5 Left 970608002 4:17699740-17699762 CCACCAAAGGAATGAAGACTGCA 0: 1
1: 0
2: 2
3: 19
4: 232
Right 970608005 4:17699758-17699780 CTGCAGAAATGGCAAACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970608005 Original CRISPR CTGCAGAAATGGCAAACAAA TGG Intronic
No off target data available for this crispr