ID: 970608450

View in Genome Browser
Species Human (GRCh38)
Location 4:17704100-17704122
Sequence CTGGGGCATGCACTGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970608450_970608456 15 Left 970608450 4:17704100-17704122 CCACACAACAGTGCATGCCCCAG 0: 1
1: 0
2: 1
3: 24
4: 208
Right 970608456 4:17704138-17704160 TTTCAGTGGACACTCAAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 115
970608450_970608455 1 Left 970608450 4:17704100-17704122 CCACACAACAGTGCATGCCCCAG 0: 1
1: 0
2: 1
3: 24
4: 208
Right 970608455 4:17704124-17704146 GATACAGGATTATCTTTCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970608450 Original CRISPR CTGGGGCATGCACTGTTGTG TGG (reversed) Intronic
900179799 1:1306098-1306120 GTGGGGCATGGACTGGAGTGGGG - Intronic
900714769 1:4137231-4137253 CTGGAGCATGCACTGTGCAGTGG + Intergenic
900765358 1:4501301-4501323 CTGGGGGAGTCACTGTTCTGGGG - Intergenic
901177821 1:7317472-7317494 CTGTGGCAAGCACTGTTCTATGG - Intronic
901304478 1:8222844-8222866 CTGGGCCATGGACTGGTCTGTGG + Intergenic
902088183 1:13879482-13879504 CTGGGGCTTGCAATGTTCTCTGG - Intergenic
903479414 1:23642265-23642287 CTGGGGCTTGCAATCTTGTAGGG - Intergenic
903582912 1:24385551-24385573 TTGTGCCATGCACTGTTCTGAGG + Intronic
903960925 1:27057402-27057424 CTGGAGCCTGCACTTTTGTGTGG + Intergenic
904451821 1:30618156-30618178 ATGGGGCTTGCACTCTTGGGGGG + Intergenic
904855804 1:33497427-33497449 CAGGGAAAGGCACTGTTGTGTGG + Intergenic
907345353 1:53773729-53773751 CTGGGGCAGGCCCTGTAGTCAGG - Intronic
907880962 1:58548917-58548939 ATGGGGAATGCACTGGCGTGAGG - Intergenic
908191889 1:61712203-61712225 CTGGGTAATTCATTGTTGTGGGG - Intronic
908322852 1:62994748-62994770 CTGGGGTCAGCACTGGTGTGCGG - Intergenic
909587686 1:77309064-77309086 CTGGGGCCTGCAGGGTGGTGGGG + Intronic
912017385 1:105059099-105059121 CTGTGGCATACACTGTTTAGGGG + Intergenic
912709810 1:111942297-111942319 GTGGGGCTTGCACTTTTGTGTGG + Intronic
913647331 1:120871014-120871036 CTGTGGCCTGCTCTGTGGTGGGG - Intergenic
914079313 1:144391846-144391868 CTGGGGCCTGCTCTGTGGTGGGG + Intergenic
914099866 1:144574656-144574678 CTGGGGCCTGCTCTGTGGTGGGG - Intergenic
914174214 1:145260393-145260415 CTGGGGCCTGCTCTGTGGTGGGG + Intergenic
914299122 1:146363025-146363047 CTGGGGTCTGCTCTGTGGTGGGG + Intergenic
914528878 1:148501577-148501599 CTGGGGCCTGCTCTGTGGTGGGG + Intergenic
914637515 1:149565531-149565553 CTGGGGCCTGCTCTGTGGTGGGG - Intergenic
916064089 1:161122079-161122101 CTGGAGCTTACACTGTTCTGGGG - Exonic
917122887 1:171659810-171659832 CTTGGGCTTGCCCTGTGGTGTGG + Intergenic
917791831 1:178504039-178504061 CTGGGGTTTGCACTCTTGAGAGG + Intergenic
919211494 1:194492778-194492800 CTGGGGCATGCTGTCTGGTGGGG - Intergenic
919723473 1:200865860-200865882 GTGGGGCAAGCACTGTTATTGGG - Intergenic
921142013 1:212317424-212317446 CTTGGGCATGCTGTGTAGTGTGG + Intronic
921345887 1:214184874-214184896 CTGCGTCAGGCACTGTTCTGGGG - Intergenic
922776858 1:228218732-228218754 TTGGGGCCTTCCCTGTTGTGGGG - Intronic
1062791356 10:308292-308314 CAGAGGCATGCAGTGGTGTGTGG + Intronic
1062957035 10:1547257-1547279 CTGGCGTATGCACTGTGGGGAGG + Intronic
1062957078 10:1547477-1547499 CTGGCGTATGCACTGTGGGGAGG + Intronic
1062957105 10:1547624-1547646 CTGGCGTATGCACTGTGGGGAGG + Intronic
1062957119 10:1547697-1547719 CTGGCGTATGCACTGTGGGGAGG + Intronic
1067787733 10:49262870-49262892 CTGGGGCAGGGACTCTTGTTTGG - Intergenic
1068721346 10:60249831-60249853 GTGGGGCATGCTGGGTTGTGGGG - Intronic
1070551393 10:77493413-77493435 CCAGGGCAGGCACTGCTGTGTGG + Intronic
1071477846 10:86040063-86040085 GTAGGGCATCCACTGTTGTGGGG + Intronic
1071503183 10:86217880-86217902 CTGAGGCAGGCTCTGTGGTGTGG - Intronic
1072223810 10:93349443-93349465 CTGGTCCATGCACAGTTGTAGGG + Intronic
1072581500 10:96744027-96744049 CTGCATCATGCCCTGTTGTGCGG + Intergenic
1072969514 10:100005169-100005191 CTGGGGCAGCCACTGTGGAGAGG + Intronic
1073327377 10:102650607-102650629 CCAGGCCATGCACTGCTGTGGGG + Intronic
1073844087 10:107532423-107532445 CTGGGGCATGCACTAATATGGGG + Intergenic
1074159565 10:110826401-110826423 CTGGGGGTTGCACTGTGGGGAGG - Intronic
1075725021 10:124606663-124606685 CTGGGCCATGCACTTTTTTGGGG + Intronic
1076348357 10:129796373-129796395 ATGGGCCAGGCACTGTTCTGGGG + Intergenic
1077436715 11:2543297-2543319 CTGGGTCATGCACTGTGCTCAGG + Intronic
1079670881 11:23169482-23169504 TTGGGCCAGGCACTGTTCTGAGG + Intergenic
1081964106 11:47159138-47159160 TTGGGGCATGCACAGGTCTGGGG + Intronic
1083675959 11:64324842-64324864 CTGGGGCATGTGTTGTTGGGTGG - Intergenic
1085844457 11:80049517-80049539 CAAGGGCATGCACTGTTCTCAGG + Intergenic
1090077215 11:123587075-123587097 CTGGGGCATGGACTGGTTGGTGG - Intronic
1092730096 12:11523181-11523203 CTGGTGCATACACAGATGTGAGG - Intergenic
1093077816 12:14775098-14775120 CTGGAGCAGGCACTGGTGGGTGG + Intronic
1094361982 12:29640440-29640462 TTGGGGCATTCACAGTTTTGTGG - Intronic
1094817748 12:34204208-34204230 CCTGGGCTTGAACTGTTGTGTGG - Intergenic
1095899182 12:47309943-47309965 CAGGGTCTTGCACTGTTGTCCGG - Intergenic
1101857786 12:108458276-108458298 CTGGGCCAGGCACTGTTGAGGGG - Intergenic
1102676087 12:114660137-114660159 CTGGGTGATTCTCTGTTGTGGGG - Intergenic
1102812116 12:115833272-115833294 CTGGGGCCTGCCCTGTTGGTAGG - Intergenic
1103331006 12:120154006-120154028 CTGAGGCAAACACTGTTTTGGGG + Intronic
1103903324 12:124314780-124314802 TAGGGGCATGCACTGTTAGGTGG + Exonic
1103977011 12:124709414-124709436 CTGGGACATGCACAGGAGTGAGG - Intergenic
1104358712 12:128112140-128112162 CTGGGGCAGGCACTGCCCTGGGG - Intergenic
1104396371 12:128437133-128437155 CTGGGGCATGTCATGTGGTGGGG + Intronic
1104471329 12:129032324-129032346 TGGGGGCATGCACTGTCGAGGGG - Intergenic
1108583344 13:51846007-51846029 CTGGGGGAGGGACTGGTGTGAGG + Intergenic
1110694038 13:78466290-78466312 CTGGGGCATGGACAGTTGTGAGG - Intergenic
1120144155 14:80961117-80961139 GTGGGGAATCCCCTGTTGTGTGG - Intronic
1120604289 14:86553610-86553632 CTGTGGCATTCACTGTAGTGTGG + Intergenic
1121658436 14:95616063-95616085 CAGGGGCATGCCCTCATGTGGGG - Intergenic
1122973709 14:105162613-105162635 CTGGGCCATGCAGTGCTTTGGGG - Intronic
1123520750 15:21070472-21070494 CTGGGGCCTGTAGTGGTGTGGGG + Intergenic
1125487764 15:40124237-40124259 CTGGGGAATTCTTTGTTGTGAGG + Intergenic
1125491838 15:40154399-40154421 CTGGGGAATTCTTTGTTGTGAGG + Intergenic
1126460931 15:48913929-48913951 CTGGGGCACTCACAGTTTTGGGG + Intronic
1127667300 15:61160955-61160977 CTGGGGCAAGCACGGATGTTTGG + Intronic
1131548566 15:93336530-93336552 CTGGAGAATTCTCTGTTGTGGGG - Intergenic
1131919108 15:97303432-97303454 CTGGGGGAAGCACAGCTGTGTGG - Intergenic
1132110484 15:99099154-99099176 CTGGGCCAGGCACAGTGGTGTGG - Intronic
1132204226 15:99975552-99975574 CTGGGGCATGAACTGGTAAGAGG + Intronic
1132385896 15:101399618-101399640 CTGGGGGAGGCACTGTTGCTGGG - Intronic
1133463227 16:6005550-6005572 CTGGGTCATTCTTTGTTGTGGGG + Intergenic
1134027260 16:10963887-10963909 CTGGGTAATTCCCTGTTGTGGGG - Intronic
1134203219 16:12215932-12215954 GTGGTGCGTGCACAGTTGTGGGG + Intronic
1134297326 16:12958556-12958578 CTGAGTCATGCTCTGTTGTCAGG + Intronic
1135218807 16:20595288-20595310 TTGGGGCATCTACTGTGGTGCGG + Intergenic
1136508880 16:30723753-30723775 CTGGGGCAGGAAGTGTGGTGGGG - Exonic
1136652354 16:31683605-31683627 CTTTGTCATGCACTGTTCTGAGG - Intergenic
1137298961 16:47127580-47127602 CTGGGGCATGCACTGGAGGCTGG + Intronic
1137588744 16:49680585-49680607 CTGGGGAATGCAGTGGTGTCCGG - Intronic
1137871959 16:51958773-51958795 ATGGAACATGCACAGTTGTGTGG + Intergenic
1140985209 16:80152302-80152324 ATGAGCCATGCACTTTTGTGCGG + Intergenic
1141855710 16:86680124-86680146 CTGTGGCAGGCACTATTTTGGGG - Intergenic
1142278449 16:89135353-89135375 CTGGAGCATGTGCTGCTGTGAGG + Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1143478844 17:7217451-7217473 CTGGGGCATGAGCTGGGGTGGGG + Intronic
1144254466 17:13452822-13452844 TTGGTGCATAAACTGTTGTGGGG + Intergenic
1144717767 17:17446230-17446252 ATGGGGAATGCAGTGTGGTGGGG + Intergenic
1144728402 17:17513130-17513152 CTGGGGCATGCTCTGTGCTAGGG + Intronic
1144993530 17:19250593-19250615 CTGGGGCCTGTACTGTTGCCTGG + Intronic
1147793838 17:43028905-43028927 CTGGGGCATGAACTGGGATGGGG + Exonic
1150627197 17:66849243-66849265 CTGATGGATGCATTGTTGTGGGG + Intronic
1151265333 17:72950957-72950979 CTGGCTCATTCTCTGTTGTGGGG - Intronic
1152305577 17:79518566-79518588 CTGGGGCCTGGACGGCTGTGGGG + Intergenic
1152802853 17:82339944-82339966 CTGGGGGAGGCACTGGTGAGAGG - Intergenic
1152846424 17:82602620-82602642 CTGGGGCATTTCCTGTTTTGTGG + Exonic
1153340342 18:3966933-3966955 TTGGGGCATTCAATGTTCTGAGG + Intronic
1157509799 18:48262811-48262833 CTGGGGCATGCTCTGTAGGCTGG - Intronic
1158535675 18:58306229-58306251 CTGGAGCATGCACAGCTCTGGGG - Intronic
1160141519 18:76327854-76327876 CTGGGGAAAGCACAGCTGTGTGG - Intergenic
1164678378 19:30118112-30118134 CTGGGGCCTCCACTGTTTGGTGG + Intergenic
1164714325 19:30380378-30380400 CTGGGCCATGCACTGCAGGGTGG - Intronic
1166324890 19:42043192-42043214 CTAGGGCAAGGACTGTTCTGTGG - Intronic
1166532247 19:43550050-43550072 CAGGGGCAGGCTCTGTTGGGAGG - Intronic
925831392 2:7899502-7899524 CTGGGGCAGACAATGATGTGGGG - Intergenic
926781863 2:16480311-16480333 CTGGGCCATGACCTGTTCTGTGG - Intergenic
929028989 2:37633481-37633503 CTGGAACAGGCACTTTTGTGAGG - Intergenic
930095037 2:47560472-47560494 CTGGGGTCTGCAGGGTTGTGTGG - Intronic
930570275 2:53077554-53077576 CTGGGGGAAGCACAGCTGTGTGG - Intergenic
930755951 2:54973003-54973025 TTTAGCCATGCACTGTTGTGAGG - Exonic
932302185 2:70675256-70675278 TTGTGGCTTGCACTGCTGTGGGG - Intronic
934028314 2:88018800-88018822 CTTGGGCTTGCACTCTGGTGGGG + Intergenic
934549846 2:95252239-95252261 CTGGGGCCTGCTGTGTGGTGGGG - Intronic
934937430 2:98475680-98475702 CTGGGGCATGCTGGGCTGTGTGG + Intronic
937096584 2:119239556-119239578 CAGGGACATGCACTGTTGATGGG + Intronic
939055176 2:137356630-137356652 CTGGAGCTTGCACTCTTGGGAGG + Intronic
949051274 2:241898834-241898856 ATGAGGCATCCACTGTTCTGGGG + Intronic
1170131503 20:13025564-13025586 CTGGTGCCTGCACTGTTCTAAGG - Intronic
1170646011 20:18196577-18196599 CTGAGTCTTGCACTGTTGTCTGG + Intergenic
1170796854 20:19555249-19555271 CTGGGACATTCACTGTTATCTGG - Intronic
1177960506 21:27660608-27660630 CTGGGGGAAGCACAGTTATGTGG - Intergenic
1177978353 21:27880257-27880279 CTGGGACATGTACCTTTGTGAGG - Intergenic
1178817988 21:35949194-35949216 ATGGGGCATGCACTGAAATGTGG + Intronic
1179284307 21:39963541-39963563 CTGAGGCATTCCTTGTTGTGGGG - Intergenic
1179307837 21:40170874-40170896 CTGGGGCATGGCCTTTGGTGTGG + Intronic
1179554019 21:42160878-42160900 CTGGGGCAAGAACTGTTCTCAGG + Intergenic
1181307067 22:21922970-21922992 CTGGGGAAAGCACTGTGGGGCGG + Exonic
1182116260 22:27758147-27758169 CTGGGGCATGCAAAGCTGCGAGG - Intronic
1182896682 22:33864742-33864764 CTGGGGAAAGCCCTGTTCTGTGG - Intronic
1183310526 22:37107170-37107192 CTGGGGCATGGACAATGGTGTGG + Intronic
1183685906 22:39361300-39361322 CGGGGGCAGGCACTGGGGTGAGG + Intronic
1184289966 22:43493375-43493397 CTGGGCCATGCACTGTTCCGTGG - Intronic
1184761819 22:46549213-46549235 CTGGGCCATGCACCATTGTTGGG + Intergenic
1184902249 22:47453753-47453775 CTGGGGCCTTCCCTGTTGTCTGG - Intergenic
950290810 3:11782779-11782801 TTGGGGCATGGACTTTTCTGTGG + Intergenic
953167019 3:40474607-40474629 CTGGTGCATTCACTGAGGTGGGG + Intergenic
953698403 3:45177821-45177843 ATGGGTCAGGCACTGTTTTGAGG - Intergenic
956226298 3:66962902-66962924 CTGTGGCATTCACTTCTGTGTGG - Intergenic
960986554 3:123284778-123284800 CTTGGCCATGAACTGCTGTGGGG + Intronic
961642934 3:128376169-128376191 CTGGGGCATGCACAGTTCTCTGG + Intronic
962891793 3:139678556-139678578 CTGAAGCATACACAGTTGTGTGG + Intergenic
969257404 4:6011641-6011663 CTGGGGCATGCAGGGATGTGGGG - Intergenic
969296896 4:6275576-6275598 CTGGGGGATGCACGGGGGTGGGG + Intronic
970608450 4:17704100-17704122 CTGGGGCATGCACTGTTGTGTGG - Intronic
973637956 4:52877292-52877314 CTGGGGCCTGCTCTGTGGAGGGG + Intronic
976656571 4:87495051-87495073 CTGGGGATTGCAGTGTTGTCAGG + Exonic
978386172 4:108177494-108177516 ATGAGGCATGGACTATTGTGGGG - Intergenic
981514386 4:145591475-145591497 CTGGGGCCTGTAGTGGTGTGGGG - Intergenic
982817804 4:159908104-159908126 TTGGGGTAAGCACTGTAGTGTGG - Intergenic
982893388 4:160884257-160884279 CTGGGGCCTGCAGTGGGGTGGGG + Intergenic
986779224 5:11048894-11048916 CTGGACCATGCTGTGTTGTGAGG + Intronic
990346859 5:54880188-54880210 CTGGGGAATGCCCTGTTGAGAGG - Intergenic
991631491 5:68660789-68660811 CTCGGTCCTGCACTGTGGTGTGG + Intergenic
998817870 5:146031931-146031953 CTGGAGCATGCATCATTGTGAGG - Intronic
999862534 5:155663877-155663899 CTGTATCAGGCACTGTTGTGAGG - Intergenic
999900209 5:156079203-156079225 CTTGGGTATTCACTGTTGTGAGG + Intronic
1000113542 5:158132517-158132539 CTAGAGCATTCCCTGTTGTGGGG + Intergenic
1001819553 5:174699247-174699269 CTGGGCTATGCCCTGTCGTGAGG - Intergenic
1001930302 5:175668199-175668221 GTGGGCCAAGCACTGTGGTGTGG + Intronic
1002335067 5:178471845-178471867 CTGGGGCATGGACTGTGGGAAGG - Intronic
1002917076 6:1538096-1538118 CTGGGGCAGGGACTGGAGTGAGG - Intergenic
1003633087 6:7806152-7806174 ATGGGGCAAGCACTGCTCTGGGG + Intronic
1004159049 6:13197307-13197329 CTGAGGCCTGCCCTGGTGTGGGG - Intronic
1006375040 6:33667367-33667389 CTGTGCCAGGCACTGTTTTGGGG + Intronic
1007291289 6:40788926-40788948 CAGGGGCAGGCCGTGTTGTGGGG + Intergenic
1007660353 6:43481195-43481217 CTGGTGCATGGGCTGTGGTGAGG + Intronic
1016335331 6:142998776-142998798 CTGGGGCCTGTAGTGGTGTGGGG - Intergenic
1016935802 6:149448760-149448782 CTGGGGCATACAGTGATGTTAGG - Intronic
1017444121 6:154492123-154492145 CTGGGGCAAATACTGCTGTGAGG - Intronic
1019360823 7:603487-603509 CTGGTGCCTGCTCTGGTGTGGGG - Intronic
1019734733 7:2645089-2645111 CTGGGGCCCTCAGTGTTGTGGGG - Intronic
1020005504 7:4781898-4781920 CTGGGGCATGCCCTGTTGACTGG + Intronic
1021774023 7:24034262-24034284 CTTGAGCTTGCACTGTTGTTTGG + Intergenic
1022635786 7:32133493-32133515 CTGGGGCATCCACTGCTGCCAGG + Intronic
1023367270 7:39476214-39476236 TTGGGCCAGGCACTGTTTTGGGG - Intronic
1024139516 7:46447677-46447699 CTGTGGCATACAATGTTGTAAGG + Intergenic
1030688557 7:112510086-112510108 CTAGGGCAGTCACTGTTGTCAGG + Intergenic
1032420762 7:131777340-131777362 CTGTGTCATGCACTGTTCTAAGG - Intergenic
1032508844 7:132455907-132455929 GTGGGGCATGCAAAGTTGTCAGG + Intronic
1037459688 8:19096512-19096534 CTGGGGCATGCAGACTTGAGGGG + Intergenic
1037872397 8:22510582-22510604 CTGCGGTATGCACTCCTGTGAGG - Intronic
1039007918 8:33061358-33061380 CTGTGGCATGCATTGTTCTGAGG - Intergenic
1041077762 8:54184806-54184828 CTGGTCCATGCACTGTAGTAAGG + Intergenic
1041364048 8:57082974-57082996 TTGGGGCACTCACTGTTTTGGGG - Intergenic
1043142121 8:76603364-76603386 GTGGGGCAAGTACTGTTGTGAGG - Intergenic
1045334464 8:101186375-101186397 GTGTGCCATGCACTGATGTGTGG - Intronic
1048149268 8:131877851-131877873 CTGGGGCCTGTCCTGGTGTGGGG - Intergenic
1048528203 8:135224081-135224103 CTGGGACCTGGACTGTTGTCAGG - Intergenic
1049251968 8:141594035-141594057 AGGGGACATGCACTGTGGTGTGG + Intergenic
1049638826 8:143705246-143705268 CTGGGGCAAGAACTGTGTTGGGG - Intronic
1049966781 9:787181-787203 GTGAGGCATACACTGTTGTGAGG - Intergenic
1050299150 9:4239149-4239171 CATGTGCATGCACTGTTGTGGGG + Intronic
1051437116 9:17044625-17044647 CTGCGGCAGGCACTGTTCTAAGG + Intergenic
1053019692 9:34686368-34686390 CTGGGGCTATCTCTGTTGTGTGG - Intergenic
1053600193 9:39602502-39602524 CTTGGGCTTGCACTCTGGTGGGG - Intergenic
1053857847 9:42356358-42356380 CTTGGGCTTGCACTCTGGTGGGG - Intergenic
1054253333 9:62739882-62739904 CTTGGGCTTGCACTCTGGTGGGG + Intergenic
1054567450 9:66774381-66774403 CTTGGGCTTGCACTCTGGTGGGG + Intergenic
1056135435 9:83625414-83625436 CTGTGGGAATCACTGTTGTGTGG + Intronic
1056508166 9:87277157-87277179 CTGGGGCCTGCATTTTTTTGTGG - Intergenic
1057208444 9:93186604-93186626 CTGGGGCAAGCTGTGTTCTGGGG + Intronic
1057496894 9:95568509-95568531 GGGGGGCATGTACTGGTGTGTGG + Intergenic
1059433102 9:114261426-114261448 CTGCGGGATGAACTGTTGAGTGG + Intronic
1061087417 9:128407205-128407227 CTGGGTCAGGCTCTGTTCTGAGG + Intergenic
1062131134 9:134893841-134893863 ATAGGGCATGCAGTGTTTTGGGG - Intergenic
1186411429 X:9347693-9347715 CTGGAGCATGCTCTGTGGTGGGG - Intergenic
1187190035 X:17025701-17025723 ATGTAGCATGCACAGTTGTGGGG + Intronic
1188440204 X:30208934-30208956 TTAGGGCATCCTCTGTTGTGGGG - Intergenic
1190988243 X:55520491-55520513 CTGGGGTATGCATTATTTTGGGG - Intergenic
1192317652 X:70065557-70065579 CTGGGGCATGGACTGGTGAAGGG + Intergenic
1195449257 X:104991754-104991776 CAGGAGCTTACACTGTTGTGGGG + Intronic
1196415670 X:115468572-115468594 CTGGGGCATGAACTCTTTTGGGG - Intergenic
1197672533 X:129293919-129293941 CTGGGGCCTGTCCTGTGGTGGGG + Intergenic
1200010886 X:153119917-153119939 CTGGGGCATCCACTGAAGAGAGG - Intergenic
1200028713 X:153280005-153280027 CTGGGGCATCCACTGAAGAGAGG + Intergenic
1200698583 Y:6382964-6382986 CTAGCGCATGCACATTTGTGAGG + Intergenic
1200742078 Y:6864588-6864610 CTGTGGATTGCACTGTTCTGTGG + Intergenic
1201035531 Y:9781735-9781757 CTAGCGCATGCACATTTGTGAGG - Intergenic