ID: 970615029

View in Genome Browser
Species Human (GRCh38)
Location 4:17760960-17760982
Sequence GACTGTGCAAATCAACTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970615029_970615038 5 Left 970615029 4:17760960-17760982 CCCAACAGTTGATTTGCACAGTC 0: 1
1: 0
2: 0
3: 4
4: 110
Right 970615038 4:17760988-17761010 CCCACTAGCCAGGGAGAATTTGG 0: 1
1: 0
2: 0
3: 12
4: 128
970615029_970615032 -4 Left 970615029 4:17760960-17760982 CCCAACAGTTGATTTGCACAGTC 0: 1
1: 0
2: 0
3: 4
4: 110
Right 970615032 4:17760979-17761001 AGTCCCCTCCCCACTAGCCAGGG 0: 1
1: 0
2: 1
3: 20
4: 194
970615029_970615031 -5 Left 970615029 4:17760960-17760982 CCCAACAGTTGATTTGCACAGTC 0: 1
1: 0
2: 0
3: 4
4: 110
Right 970615031 4:17760978-17761000 CAGTCCCCTCCCCACTAGCCAGG 0: 1
1: 0
2: 1
3: 23
4: 317
970615029_970615041 14 Left 970615029 4:17760960-17760982 CCCAACAGTTGATTTGCACAGTC 0: 1
1: 0
2: 0
3: 4
4: 110
Right 970615041 4:17760997-17761019 CAGGGAGAATTTGGCAATGTCGG 0: 1
1: 0
2: 4
3: 28
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970615029 Original CRISPR GACTGTGCAAATCAACTGTT GGG (reversed) Intronic
901623407 1:10607538-10607560 GACTGAGAAGACCAACTGTTGGG - Intronic
903278237 1:22234883-22234905 GAATTTGCAAAGCAGCTGTTAGG + Intergenic
903551381 1:24159304-24159326 GACTGTGCAAACCAAGGTTTGGG + Intronic
910142999 1:84047114-84047136 GACAGTGGAAATCAAGAGTTTGG - Intergenic
920413460 1:205781038-205781060 ATATGTGCAAATCAATTGTTTGG - Intergenic
923488071 1:234455389-234455411 GACTGGACAACTCAACAGTTCGG + Intronic
1067745848 10:48935109-48935131 AACTGTGCCAAACAACTGCTTGG - Intronic
1071188226 10:83068821-83068843 GACTTTTTAAATCAAATGTTTGG + Intergenic
1071273190 10:84027825-84027847 GAATGAGAAAATCACCTGTTAGG + Intergenic
1072796547 10:98359999-98360021 GACTGTGCAATTCCACTCCTAGG + Intergenic
1076268049 10:129125831-129125853 GAGTGTACAGATCATCTGTTGGG - Intergenic
1079427950 11:20361837-20361859 GCCTGTGAAAATAAACTTTTAGG + Intergenic
1080633043 11:34097234-34097256 GACTGTGTATAACCACTGTTTGG - Exonic
1085659295 11:78348699-78348721 GACTGAGCCATTCAACTGCTGGG + Intronic
1085795201 11:79532999-79533021 GAATCTGCAAAGCAACAGTTGGG + Intergenic
1085928555 11:81053379-81053401 AACTGTGCAAATCAAGTGGTGGG + Intergenic
1087937632 11:104053645-104053667 GAGGGGGCAAATCAACTATTTGG + Intronic
1090230594 11:125100408-125100430 GACAGTGCAAACAAAGTGTTTGG + Intronic
1099672883 12:85717557-85717579 GAGTGTGCAAGTCAAATGTAGGG - Intergenic
1102691712 12:114766432-114766454 CACTGTGCATTTCAACTTTTTGG - Intergenic
1107313352 13:39104393-39104415 GACTGTACACTTCAACTGATTGG + Intergenic
1109203597 13:59457678-59457700 TACTGTGTATATCACCTGTTAGG + Intergenic
1114809846 14:25885344-25885366 TACTGTGAGAACCAACTGTTTGG + Intergenic
1115857070 14:37641902-37641924 AACTATGCTAATCAACTGTATGG - Intronic
1118472280 14:66085687-66085709 GAGTGTGCATATAAATTGTTCGG - Intergenic
1119497368 14:75091595-75091617 AACAGTGCAAGTCAAATGTTAGG + Intronic
1120554245 14:85908667-85908689 TAGTTTGCCAATCAACTGTTAGG - Intergenic
1121162782 14:91760466-91760488 GACTGTGTAGATCAACCTTTAGG - Intronic
1125775385 15:42208090-42208112 GCCTCTGCAAATCGACTGTCTGG - Exonic
1126714441 15:51499599-51499621 GACTGAGCAAACCAACAGTAAGG - Exonic
1128630598 15:69262439-69262461 GACTATGCAAAAGAACTTTTGGG + Intronic
1131300374 15:91194488-91194510 GACTCTGCAAATCCACTCCTGGG - Intronic
1137407838 16:48204149-48204171 GACTCAGCAAATTCACTGTTAGG - Intronic
1140322335 16:73965333-73965355 GACAGTGCAAATGAAGTGTTTGG - Intergenic
1141728126 16:85803937-85803959 AAATGTGCAAATCACATGTTTGG - Intronic
1151303623 17:73248165-73248187 GGCTGTGCAAATGAACTGATAGG - Exonic
1155674042 18:28408191-28408213 GAGTGTGTAGATCAAGTGTTTGG - Intergenic
1158335136 18:56407786-56407808 GACTGTGGGAAACAGCTGTTTGG + Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1165617284 19:37213051-37213073 GACTGAGCAATTAAACTGTAAGG + Intronic
925165339 2:1712444-1712466 GACTGTGGAAGACAACTGTTTGG + Intronic
928592405 2:32831176-32831198 GACTCTGCATACCAAGTGTTAGG + Intergenic
928708015 2:33972441-33972463 GATTCTCCATATCAACTGTTAGG + Intergenic
931650377 2:64463070-64463092 GGCTGTGCAACCCAACAGTTAGG - Intergenic
932299839 2:70658714-70658736 GACTGTGCCAACCAACTCTAGGG + Exonic
936107608 2:109638647-109638669 TACTGTGCAAACCTACTCTTTGG - Intergenic
939175469 2:138742771-138742793 GACTTTGCAAAACTACAGTTAGG - Intronic
939973123 2:148684579-148684601 GACTGTTGATACCAACTGTTTGG + Intronic
940150351 2:150593450-150593472 GAATAAGCAAAACAACTGTTAGG + Intergenic
940605093 2:155912796-155912818 AACTTTGTAAATCAAGTGTTTGG + Intergenic
941408605 2:165124328-165124350 TACTTTGGAAACCAACTGTTCGG + Intronic
945274747 2:207977062-207977084 GACTGTCCAAAACAACTGGAAGG - Exonic
945494113 2:210489360-210489382 GACAGAGCAAATCTTCTGTTGGG + Intronic
946276358 2:218634632-218634654 TACAGTGGAAATAAACTGTTGGG + Intronic
1168749482 20:272338-272360 TACTGTCCAAGTCAACTGTATGG + Intronic
1168823983 20:796542-796564 GTTTGAGCAGATCAACTGTTGGG - Intergenic
1173242335 20:41308452-41308474 GATTGAGCAAATCAAGTTTTAGG + Intronic
1177736287 21:25094001-25094023 GATGGTGCAATTCATCTGTTTGG - Intergenic
1178621817 21:34183800-34183822 GACTTTGGAAGTCAGCTGTTTGG + Intergenic
1181832169 22:25569552-25569574 GACTTTGCCAAACATCTGTTTGG + Intronic
1183654684 22:39177667-39177689 GATTCTGAAATTCAACTGTTTGG + Intergenic
949694610 3:6680274-6680296 GCCTGTGGAAATAAACTGCTGGG + Intergenic
956936644 3:74109352-74109374 GATTGTGCAAAGCAACAATTGGG - Intergenic
957031093 3:75242466-75242488 GAATGTGGAAATCTACTGTCTGG - Intergenic
958133077 3:89454568-89454590 GGCTGTGCAAAAAAAATGTTTGG - Intronic
962140074 3:132781003-132781025 GACTGGGCAAACCAACTGAAAGG - Intergenic
966486568 3:180477724-180477746 GACTTTTCAAATAAATTGTTTGG + Intergenic
967252866 3:187561038-187561060 GACTGTGCAATGCACCTGTCCGG - Intergenic
967514409 3:190349619-190349641 AACTATGCAAGTCAACGGTTGGG - Intronic
970581132 4:17475129-17475151 GATTGTGCTAATTAACTGTACGG + Intronic
970615029 4:17760960-17760982 GACTGTGCAAATCAACTGTTGGG - Intronic
973934701 4:55831943-55831965 GACTGTGAAAATCACTTGTCAGG - Intergenic
976147585 4:82057226-82057248 GACTGTGCACATCGACTATAAGG + Intergenic
976197117 4:82543849-82543871 TACTGTGGAAATGAACTGATTGG - Intronic
980516738 4:133872472-133872494 ATCTGTGGAAATAAACTGTTAGG + Intergenic
984255481 4:177385111-177385133 CACTGTGAAAATCATCTCTTTGG + Intergenic
984361090 4:178733519-178733541 GACTTCTCAAATCCACTGTTGGG + Intergenic
985172497 4:187167051-187167073 GACTGTGCAAATAAGGTGTCAGG - Intergenic
989244029 5:39233209-39233231 GGCTGGGCAAATAAACGGTTTGG + Intronic
991052166 5:62284943-62284965 GAATGGGCAAATAACCTGTTAGG + Intergenic
993180510 5:84546616-84546638 GACTGTTCAAAGTAACTGTAGGG + Intergenic
997031177 5:130130588-130130610 GACAGTGAACATCAACAGTTGGG - Intronic
997934035 5:138095337-138095359 GCCTTTGCAAATCAAAAGTTAGG - Intergenic
1000934133 5:167287776-167287798 GAGTATGCAAATCACCTGTCTGG + Intronic
1003903614 6:10678503-10678525 GACTCTGCCAAAAAACTGTTAGG - Intronic
1005396894 6:25391809-25391831 GTCAGTGCAAACCAAGTGTTTGG + Intronic
1006136351 6:31898339-31898361 GACTGTGCTTATGAAGTGTTCGG - Intronic
1012010599 6:93779496-93779518 GACTGCTGAAAACAACTGTTGGG - Intergenic
1014748247 6:125225362-125225384 GACTCAGCAATTCCACTGTTAGG - Intronic
1014940453 6:127432236-127432258 GCTTGCCCAAATCAACTGTTTGG - Intergenic
1018208493 6:161457677-161457699 GAATATGAAAATCTACTGTTAGG + Intronic
1018430574 6:163718478-163718500 AACTGAGCAAACCCACTGTTTGG - Intergenic
1019012937 6:168856893-168856915 TACTGTGTAAATCAGCAGTTCGG + Intergenic
1024917400 7:54516864-54516886 GACTCTACAAAAAAACTGTTAGG - Intergenic
1024953226 7:54887288-54887310 GACAGTGCAATTCCACTGCTGGG + Intergenic
1027966874 7:85023170-85023192 GAGTCTGCAAAGAAACTGTTAGG + Intronic
1028018261 7:85741508-85741530 GATTGGGCAGACCAACTGTTGGG + Intergenic
1030332203 7:108283256-108283278 TACTTTGAAATTCAACTGTTAGG - Intronic
1035628264 8:1089904-1089926 AGCTGTGCAAATCCACTGCTTGG + Intergenic
1038837596 8:31144766-31144788 GCCTTTGCAAACTAACTGTTTGG - Intronic
1040131291 8:43799946-43799968 GAATCTGCAAATGAACTTTTGGG + Intergenic
1042154541 8:65828739-65828761 GACTGACAAAATCCACTGTTGGG - Intronic
1045362935 8:101449693-101449715 GACTGGGCACACAAACTGTTGGG - Intergenic
1057567282 9:96176789-96176811 GACTGTGCAAAACATCTCTAAGG + Intergenic
1058079136 9:100683516-100683538 GACTTTGCAAATCCACTCCTAGG + Intergenic
1186404196 X:9287354-9287376 AACTGATCAAATCCACTGTTTGG + Intergenic
1187614202 X:20975481-20975503 GATTGAGAAAATCATCTGTTTGG - Intergenic
1193576786 X:83208980-83209002 GAATGTAAAAATCAACTTTTTGG + Intergenic
1193861168 X:86670056-86670078 AAATGTACAAATCAACTGTAAGG + Intronic
1194900590 X:99505157-99505179 GAGTGTGGAAATTAAGTGTTAGG - Intergenic
1198006140 X:132495696-132495718 GACTGTTTAAATCAACTATGGGG + Intergenic
1198722001 X:139633009-139633031 GACTCTGCAGTTGAACTGTTGGG - Intronic
1199275785 X:145940319-145940341 AACTGAGCAAATAAACCGTTAGG - Intergenic
1199587342 X:149429937-149429959 GACTCTGCCAAAAAACTGTTAGG + Intergenic
1199599267 X:149532072-149532094 CACTGGGCAAATCAACTTTCTGG + Intronic