ID: 970617438

View in Genome Browser
Species Human (GRCh38)
Location 4:17781344-17781366
Sequence CGCACGCACGTGCACACGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 56}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970617438_970617447 15 Left 970617438 4:17781344-17781366 CCCACCGTGTGCACGTGCGTGCG 0: 1
1: 0
2: 0
3: 6
4: 56
Right 970617447 4:17781382-17781404 GCGTGTGGGTTTCTCGGGAGAGG 0: 1
1: 0
2: 2
3: 10
4: 122
970617438_970617444 1 Left 970617438 4:17781344-17781366 CCCACCGTGTGCACGTGCGTGCG 0: 1
1: 0
2: 0
3: 6
4: 56
Right 970617444 4:17781368-17781390 GCGCGGGCGTGCGAGCGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 121
970617438_970617443 0 Left 970617438 4:17781344-17781366 CCCACCGTGTGCACGTGCGTGCG 0: 1
1: 0
2: 0
3: 6
4: 56
Right 970617443 4:17781367-17781389 CGCGCGGGCGTGCGAGCGTGTGG 0: 1
1: 0
2: 0
3: 28
4: 197
970617438_970617446 10 Left 970617438 4:17781344-17781366 CCCACCGTGTGCACGTGCGTGCG 0: 1
1: 0
2: 0
3: 6
4: 56
Right 970617446 4:17781377-17781399 TGCGAGCGTGTGGGTTTCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 85
970617438_970617448 18 Left 970617438 4:17781344-17781366 CCCACCGTGTGCACGTGCGTGCG 0: 1
1: 0
2: 0
3: 6
4: 56
Right 970617448 4:17781385-17781407 TGTGGGTTTCTCGGGAGAGGTGG 0: 1
1: 1
2: 1
3: 21
4: 279
970617438_970617445 9 Left 970617438 4:17781344-17781366 CCCACCGTGTGCACGTGCGTGCG 0: 1
1: 0
2: 0
3: 6
4: 56
Right 970617445 4:17781376-17781398 GTGCGAGCGTGTGGGTTTCTCGG 0: 1
1: 0
2: 1
3: 11
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970617438 Original CRISPR CGCACGCACGTGCACACGGT GGG (reversed) Exonic
901232816 1:7650655-7650677 TCCCCGCATGTGCACACGGTGGG + Intronic
901316442 1:8312978-8313000 GGCACACACGGGCACACTGTGGG - Intergenic
901517070 1:9755061-9755083 CGCACACACGTTTACTCGGTGGG + Intronic
907309218 1:53529786-53529808 CGCACCCACCTAGACACGGTAGG - Exonic
911603588 1:99874512-99874534 TGCACACACGTGCACACAGCAGG + Intronic
916233407 1:162561886-162561908 CGCACGAACGTGCACAGCGCGGG + Intronic
1073495298 10:103885308-103885330 CACACAGACCTGCACACGGTAGG + Intronic
1083332441 11:61905246-61905268 CACAAGCACGTGCACACAGGAGG + Intronic
1096293969 12:50367669-50367691 TGCACGCACATGCACACAGAGGG - Intronic
1096994617 12:55830811-55830833 CGCGCGCGCGTGCGCGCGGTGGG - Intronic
1101717236 12:107321269-107321291 CACACGCACATGCACACCCTTGG - Intronic
1104961271 12:132489734-132489756 CGCCCGCAGGTGCCCACGGAGGG + Exonic
1112310219 13:98311582-98311604 TGCACACACGTGCACACGTTGGG + Intronic
1113595904 13:111532155-111532177 CGCACACACGTGCACAGAGGAGG + Intergenic
1113727256 13:112614509-112614531 CGCACGCGCGAGCACAGGCTTGG - Intergenic
1121744431 14:96277156-96277178 CGCAGGCATTTGCACACAGTAGG + Intergenic
1122924629 14:104893977-104893999 CACATACACGTGCACACGGGAGG - Intronic
1128981009 15:72185546-72185568 CACATGCACGTGCACCCTGTTGG - Intronic
1131778680 15:95830257-95830279 CACACACACATACACACGGTTGG + Intergenic
1132798235 16:1736690-1736712 CACACGGACGCTCACACGGTCGG - Intronic
1135698553 16:24611335-24611357 TGCACGCACGTACACACAGCGGG - Intergenic
1142341669 16:89527243-89527265 CCAACGGACTTGCACACGGTTGG - Intronic
1146163485 17:30571951-30571973 GGCACGCACATGCACACGCACGG - Intergenic
1149905021 17:60518341-60518363 CACACGCACGCACACACGGCTGG - Intronic
1152737850 17:82006073-82006095 AGCACACACGTGCACACGCAAGG - Intronic
1153457574 18:5296441-5296463 CCCACGCACATGCACACGCACGG - Intronic
1158893437 18:61893745-61893767 CGCGCGCACGTGCACACCCAGGG + Exonic
1160265402 18:77337425-77337447 CCCAGGCAGGTGCACATGGTAGG - Intergenic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160902916 19:1438093-1438115 CGCACCTACGAGCAAACGGTAGG + Intergenic
1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG + Intronic
1164245348 19:23423364-23423386 CACACACACGTGCACATGGTGGG - Intergenic
1164308713 19:24028182-24028204 CACACACACGTGCACATGGTGGG + Intergenic
1168120123 19:54247372-54247394 AGCACGCGCCTGCACACAGTAGG - Intronic
1168514797 19:57002363-57002385 CGCACGCCTCTGCAAACGGTTGG - Intergenic
1168724551 19:58573556-58573578 CGCGCGCACGTACACACGAAGGG - Exonic
925905141 2:8535635-8535657 TGCACACACGTGCACACGCATGG - Intergenic
929778599 2:44943463-44943485 CACACGCACACGCACACGCTAGG - Intronic
931928778 2:67105416-67105438 TGCATGCACGTGCACATGCTGGG + Intergenic
937150701 2:119683748-119683770 CGCACACACATACACACGGCTGG - Intronic
1175598481 20:60254234-60254256 CACACACACGTGCACACGTATGG + Intergenic
1176094962 20:63336447-63336469 CGCACACACGTGCACACACAGGG - Intergenic
1184163318 22:42712336-42712358 CACACGCACATGCACACGTGGGG + Intronic
1185335145 22:50267998-50268020 CGCACGCGCGTGGACCCGGGCGG + Intronic
952254430 3:31683362-31683384 CGCACGCGCGTGCACAGCATGGG + Intronic
954424285 3:50435170-50435192 CGCAGGCACGTGCACACAAACGG - Intronic
963877679 3:150494795-150494817 CACGCACACGTGCACACAGTAGG + Intergenic
965539024 3:169853901-169853923 CACAGGCACCTGCACATGGTTGG - Intronic
969409134 4:7016398-7016420 CGCAGTCAAATGCACACGGTGGG - Intronic
970617438 4:17781344-17781366 CGCACGCACGTGCACACGGTGGG - Exonic
985578139 5:683149-683171 CGCAGGCAAGTGCCCATGGTAGG + Intronic
992939791 5:81750906-81750928 CGCACGCACTCGCACACTCTGGG - Intronic
1002599919 5:180348263-180348285 GGCACACACGTGCACACGCTCGG - Intronic
1021485893 7:21168230-21168252 CACACACACGTGCACACGTAGGG - Intergenic
1040471558 8:47738641-47738663 CTCACGCGCGTGCCCACGGTCGG - Exonic
1042734393 8:71971301-71971323 GGCACCCACGTGCACACGCAGGG + Intronic
1051350171 9:16191584-16191606 CACACGCACATGCATATGGTGGG - Intergenic
1061012139 9:127961971-127961993 CGCATACACGTGGACACCGTGGG - Intronic
1062537665 9:137027985-137028007 CGCGCGCACGTGCGGACGGCCGG - Intronic
1062567484 9:137169792-137169814 GGCACGCACGTGCACACCTCGGG + Exonic
1062607401 9:137354330-137354352 CGAACTCACCTGCACATGGTCGG + Exonic
1189617031 X:42794449-42794471 CGCACGCACCTGCAACCGTTGGG + Intergenic
1195696742 X:107673117-107673139 CGCACGCACGCACACACGGAGGG - Intergenic