ID: 970619156

View in Genome Browser
Species Human (GRCh38)
Location 4:17799286-17799308
Sequence ATATGTGAAGGGCCAACATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970619152_970619156 21 Left 970619152 4:17799242-17799264 CCATTCAATTCTTTTATATGATT No data
Right 970619156 4:17799286-17799308 ATATGTGAAGGGCCAACATATGG No data
970619153_970619156 -4 Left 970619153 4:17799267-17799289 CCACTATAAGCTATTTTCAATAT No data
Right 970619156 4:17799286-17799308 ATATGTGAAGGGCCAACATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970619156 Original CRISPR ATATGTGAAGGGCCAACATA TGG Intergenic
No off target data available for this crispr