ID: 970624097

View in Genome Browser
Species Human (GRCh38)
Location 4:17858394-17858416
Sequence TCTCCTCTCTCCTCTCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1368
Summary {0: 1, 1: 2, 2: 26, 3: 196, 4: 1143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970624097_970624102 18 Left 970624097 4:17858394-17858416 CCAGAAGGAGAGGAGAGAGGAGA 0: 1
1: 2
2: 26
3: 196
4: 1143
Right 970624102 4:17858435-17858457 AAGAAATTGGCCAGGTGCAGTGG No data
970624097_970624100 5 Left 970624097 4:17858394-17858416 CCAGAAGGAGAGGAGAGAGGAGA 0: 1
1: 2
2: 26
3: 196
4: 1143
Right 970624100 4:17858422-17858444 AGAAATACATTTAAAGAAATTGG 0: 1
1: 0
2: 3
3: 153
4: 1374
970624097_970624101 10 Left 970624097 4:17858394-17858416 CCAGAAGGAGAGGAGAGAGGAGA 0: 1
1: 2
2: 26
3: 196
4: 1143
Right 970624101 4:17858427-17858449 TACATTTAAAGAAATTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970624097 Original CRISPR TCTCCTCTCTCCTCTCCTTC TGG (reversed) Intronic
900153730 1:1194885-1194907 TCCTTTCTCTTCTCTCCTTCTGG + Intronic
900169762 1:1261167-1261189 CCTGCCCTCTGCTCTCCTTCAGG - Intronic
900552626 1:3264377-3264399 TCTCCCCTTTCCTCCCCTCCTGG - Intronic
900552640 1:3264429-3264451 TCTCCCCTTTCCTCTCCTCCTGG - Intronic
900552654 1:3264481-3264503 TCTCCCCTTTCCTCTCCTCCTGG - Intronic
900684644 1:3940306-3940328 TCTCCTCCATCCCCTCCCTCAGG + Intergenic
900690139 1:3975857-3975879 GCTCCTCCCTCCCCTCCTCCAGG - Intergenic
900691752 1:3984857-3984879 TCCTCTCTCCCCGCTCCTTCTGG - Intergenic
900973790 1:6005585-6005607 TCCCCTCTCTCCCCTCCTGCTGG + Intronic
901112810 1:6812037-6812059 CCACCGCTCTCTTCTCCTTCAGG + Intronic
901387786 1:8922445-8922467 TCTCTTCTCTACCCTCTTTCTGG + Intergenic
901393136 1:8960808-8960830 TTCTCTCTCTCCTTTCCTTCTGG - Intronic
901506277 1:9687898-9687920 TCTCTTCTCTCTCCTCCTTGGGG + Intronic
901837069 1:11931149-11931171 TCTCCTCCCTCTGCTCCTCCTGG + Intergenic
901928259 1:12580615-12580637 TCTCCTCCGTCGTCTCCTTCAGG + Exonic
902203898 1:14853311-14853333 TCTCCTCTGTCCTCTCCCATTGG - Intronic
902621997 1:17656112-17656134 GCTGCTCTCACCCCTCCTTCCGG - Intronic
903126516 1:21251879-21251901 TGTCCTCTCTGCCCTCCTCCTGG + Intronic
903574332 1:24329054-24329076 CCTCTTCTCACCTCTCCTTGAGG + Intronic
903666170 1:25008975-25008997 CCTCCTCTGTCCTCTCCTCTTGG - Intergenic
904487870 1:30839697-30839719 TCTTCTCTCTCATCTCCTCATGG - Intergenic
904565962 1:31428665-31428687 CCTCCTCCCTGCTCTCCGTCTGG - Intronic
904924168 1:34032981-34033003 TTTCCTGTCTCCTCTCTTTCTGG + Intronic
905133922 1:35783324-35783346 TTTTCTCTCCCCTCTCCATCTGG + Intergenic
905162353 1:36047543-36047565 TTCCCTTTCTCTTCTCCTTCTGG - Intronic
905181562 1:36170453-36170475 TCTCCTTTCTGCTTTACTTCTGG - Intronic
905182361 1:36175205-36175227 TCTCTGTTCTCCTCTCCTACAGG - Intronic
905452385 1:38064983-38065005 TCTTCTCTCCCCTATCCTTGGGG - Intergenic
905452541 1:38065955-38065977 TCTTCTCTCCCCTCTCCTTGGGG + Intergenic
905488002 1:38320053-38320075 TTCCCTCTTTCTTCTCCTTCTGG + Intergenic
905921076 1:41719155-41719177 GCTCCTCTCTCTCCTCCTCCAGG - Intronic
905944221 1:41888434-41888456 TCTCCTCTCTCCTCACATATCGG - Intronic
906484266 1:46222188-46222210 TCTGCTCTCTCCTCAGTTTCCGG - Intergenic
906533372 1:46536707-46536729 TTCTCTTTCTCCTCTCCTTCTGG + Intergenic
907374216 1:54022285-54022307 TCTACTGTCTGCTCTCTTTCTGG + Intergenic
907476798 1:54711205-54711227 ACTCCTCTCCCCTCTCTCTCTGG - Intronic
907685073 1:56602679-56602701 TCTCCTCTCTCCTTCTCCTCTGG + Intronic
907727178 1:57030417-57030439 TCACATGGCTCCTCTCCTTCAGG - Intronic
907743288 1:57187904-57187926 TCTCCTCTCCTCCCTCCTTGCGG - Intronic
908088107 1:60658313-60658335 TCTCCTCTCTTCTCTGTTGCTGG - Intergenic
908320191 1:62971267-62971289 TCTCCTCACCCCCTTCCTTCTGG - Intergenic
908347441 1:63249765-63249787 TCCACTCTCTCTTCTCCTTTTGG - Intergenic
908870669 1:68608095-68608117 TCGCCTTTCTTCTCTTCTTCAGG - Intergenic
908982506 1:69976006-69976028 TTTCTCCTCTCCTCTCATTCAGG + Intronic
909359821 1:74747145-74747167 TCACCTCTCTCCTTAACTTCTGG - Intronic
909887648 1:80962646-80962668 TCAGCTTTCTCCTCTCCTCCAGG - Intergenic
909930265 1:81489510-81489532 TCCTGTCTCTCCTCTACTTCTGG - Intronic
909989403 1:82204418-82204440 TCTCCTTTTTCCACTCCTTTGGG - Intergenic
910058788 1:83063850-83063872 TGCCCTCTCTCCCTTCCTTCAGG + Intergenic
910126579 1:83849238-83849260 TCTCCTTTATCATCTCCCTCTGG + Intergenic
910184411 1:84521525-84521547 TATGCTCTCCCATCTCCTTCAGG + Intergenic
910219530 1:84876441-84876463 TCTCCTGCCTCCTCCCCTCCAGG + Intronic
910252124 1:85208743-85208765 CCTCCTCCCTCCTTTCATTCAGG + Intergenic
910292480 1:85612868-85612890 TCTCATCTCTGCTCTCTTTTTGG - Intergenic
910639815 1:89447239-89447261 TTTCCACTCTCCTCTCCTCAAGG + Intergenic
910782310 1:90952761-90952783 TATTCTCTCTTCTTTCCTTCCGG - Intronic
910821487 1:91354383-91354405 TTTCCTCATTCTTCTCCTTCTGG - Intronic
911018860 1:93366092-93366114 CCTCCTCTCTCCTCAGCCTCTGG + Exonic
912127281 1:106554903-106554925 TCTTCCCTCTCCTCTCCTCAAGG - Intergenic
912282094 1:108326850-108326872 TTTTATCTCTCTTCTCCTTCTGG + Intergenic
912328339 1:108791446-108791468 TCCTCTCTCTTCTCTCTTTCTGG + Intronic
912372706 1:109186178-109186200 GCTCCTCCCTCATCTCCTTCAGG - Intronic
912666029 1:111580525-111580547 TCTTCTCTCTTCTGTCTTTCTGG - Intronic
912755541 1:112321770-112321792 CATCCTCTCTCCACTCCCTCTGG + Intergenic
912934993 1:113995255-113995277 TTTCCCTTCTCTTCTCCTTCTGG - Intergenic
913028530 1:114872626-114872648 TTTTCTCTTTCTTCTCCTTCTGG + Intronic
913125523 1:115784147-115784169 CCTCCTCTCTCTGCTCTTTCAGG - Intergenic
913394929 1:118356989-118357011 CCTAATCTCTCCTCTCCTTCTGG - Intergenic
913688161 1:121253580-121253602 CCTCCATTCTACTCTCCTTCTGG - Intronic
914040017 1:144041223-144041245 CCTCCATTCTACTCTCCTTCTGG - Intergenic
914149441 1:145026697-145026719 CCTCCATTCTACTCTCCTTCTGG + Intronic
915001698 1:152600263-152600285 TCTCCTACCTCCTCTGCATCTGG + Intronic
915019892 1:152769211-152769233 TCTCATATTTCCTCTCCCTCTGG - Intronic
915070847 1:153264838-153264860 CACCCTTTCTCCTCTCCTTCTGG - Intergenic
915215863 1:154340472-154340494 TCTTTTCTCTCCCCTCCCTCTGG + Intronic
915263192 1:154694423-154694445 TCTCCTCTCCCCTCTGCCTTTGG + Intergenic
915418815 1:155763446-155763468 TCTTCTTCCTCCTCTTCTTCTGG + Exonic
915799920 1:158779721-158779743 TCATCTCTCTTCTCTCCATCTGG + Intergenic
916329726 1:163601139-163601161 TCTCCTGTCTGCTGTGCTTCTGG + Intergenic
916685999 1:167147376-167147398 TTCTCTCTCTCTTCTCCTTCTGG + Intergenic
916915957 1:169407027-169407049 TCTTTTTTCTCCTCTCCTTCTGG - Intronic
917004141 1:170394008-170394030 TTTTCTCTCTTCTCTCCTTCTGG + Intergenic
917664414 1:177210139-177210161 TATCTTCTGTCCTCTGCTTCTGG + Intronic
917875134 1:179279645-179279667 CTTTCTCTATCCTCTCCTTCTGG + Intergenic
917917232 1:179714649-179714671 TTTCCTCTCTCATCTCCTTTGGG + Intergenic
918421536 1:184369109-184369131 TCTTCTCTCTCCTCAGCCTCTGG - Intergenic
918544561 1:185667918-185667940 TATCCTCCCTCCTCAGCTTCTGG + Intergenic
918570805 1:185989560-185989582 TCCCCACTCTCCTCTCCTCCAGG - Exonic
918771734 1:188569510-188569532 TTTTCTCTCTCCTCTAATTCTGG - Intergenic
918908670 1:190534389-190534411 TTTCATATCTCCTCTCCTTTCGG - Intergenic
919784545 1:201250934-201250956 TCACCTCTCTCAGCTCCTGCTGG - Intergenic
919831014 1:201539962-201539984 TCCTCTCTCCCCTCTCCTCCGGG - Intergenic
919931464 1:202223907-202223929 TCTCCTCTTGCCTTTCCCTCGGG - Intronic
919972436 1:202589953-202589975 CCACCTGTCTCCTCTCCTTGAGG - Exonic
920279837 1:204834530-204834552 CCTCCTCACTCCTCCCCTCCCGG + Intronic
920475483 1:206272079-206272101 CCTCCATTCTACTCTCCTTCTGG - Intronic
920941245 1:210485096-210485118 TCTTCTCTCTCTTGTTCTTCTGG - Intronic
921248109 1:213267976-213267998 TTCCCTTTCTCCTCTCCTTCTGG - Intronic
921272591 1:213486075-213486097 TCTCCTCTCTCCTTCCCAGCAGG + Intergenic
921325678 1:213984688-213984710 TTTCCTCTCTTCCCTTCTTCAGG + Intronic
921435522 1:215115658-215115680 TTTCCTCTCTCCTTGCCTTTTGG + Intronic
921957419 1:220998838-220998860 TGTCTTCTCTCCTTGCCTTCGGG - Intergenic
922006955 1:221541051-221541073 TCTTCTCTCCCCTCTTCCTCTGG + Intergenic
922378873 1:225000484-225000506 TCTTCTTTAACCTCTCCTTCTGG + Intronic
922404337 1:225297080-225297102 TTTCCCTTCTCTTCTCCTTCTGG + Intronic
922568423 1:226617198-226617220 TCTCCTCTTGTCCCTCCTTCTGG - Intergenic
922617596 1:226971934-226971956 ACTATTCTCTCCTCTCTTTCTGG + Intronic
922619420 1:226980918-226980940 TCACCTCTCTCTTCCCCTGCTGG + Intronic
922633301 1:227136431-227136453 TGCACTTTCTCCTCTCCTTCTGG - Intronic
922770451 1:228179517-228179539 TATTCTCTTTCCCCTCCTTCTGG - Exonic
922888409 1:229039157-229039179 TCCTTTCTCTCTTCTCCTTCTGG - Intergenic
922977720 1:229799134-229799156 TCTCCTGTCTGCTCTCCTCTTGG - Intergenic
923190889 1:231619604-231619626 TCTCCTGTCTCATCTTCCTCTGG + Intronic
923496765 1:234532180-234532202 TTTTCTCTCTCTTTTCCTTCAGG - Intergenic
923560661 1:235038324-235038346 TGCTCTCTTTCCTCTCCTTCTGG - Intergenic
923663601 1:235979669-235979691 TCCCCTCTCCCTTATCCTTCTGG - Intronic
923696576 1:236257969-236257991 TTTTCTCTTTCTTCTCCTTCTGG - Intronic
924838846 1:247686837-247686859 TCTCCTCCCTTCCCACCTTCTGG - Intergenic
1062792264 10:315767-315789 TTTTCTCTCACCGCTCCTTCTGG + Intronic
1063156223 10:3381640-3381662 TGTCCTCTGTCTTCTCCTCCAGG - Intergenic
1063296287 10:4810041-4810063 TGTCCTCCCACCTCTCCTTAAGG + Intronic
1063470840 10:6283563-6283585 TCTGCTCTTTCCTCTCATTCAGG - Intergenic
1064405685 10:15060051-15060073 CCTCTTCTCTTCTCTCCTTCTGG + Intronic
1064706934 10:18082664-18082686 TTTCTTCTCTCATATCCTTCTGG + Intergenic
1064812216 10:19213187-19213209 TCTTCCCTCTCCTCTCCTTTGGG + Intronic
1064848046 10:19678327-19678349 TGTCCTCTCTGCTTTCCTTGAGG + Intronic
1064927366 10:20583812-20583834 TCTTCTCTTTCTTTTCCTTCTGG + Intergenic
1065023902 10:21523716-21523738 TCTCCTCTCTCCCCTCGTGGTGG - Exonic
1065170667 10:23023897-23023919 TACCCTCTCTCCTCTCCTTCTGG - Intronic
1065203048 10:23331614-23331636 TCTCCCCTCCCCTCCCCTCCCGG - Intronic
1065264183 10:23957762-23957784 TCTCCTCCCTCCTCCCATCCAGG + Intronic
1065318585 10:24487807-24487829 CTTCCTATGTCCTCTCCTTCTGG - Intronic
1065607451 10:27433051-27433073 TTTTCTCTCTTCTCTCCATCTGG - Intergenic
1065853635 10:29812522-29812544 TCTCTTTTCTCCTTCCCTTCTGG + Intergenic
1065978900 10:30870991-30871013 TCTCCCCTTTCCTCTCCATCTGG - Intronic
1066166962 10:32798767-32798789 TCTCTTCACTGCTGTCCTTCAGG + Intronic
1066598575 10:37079071-37079093 TTTCCTCCCTCTTCCCCTTCAGG - Intergenic
1066626375 10:37410168-37410190 TTCTCTCTTTCCTCTCCTTCTGG - Intergenic
1067122053 10:43481448-43481470 TTTCCTGTCTCTTCTCCATCAGG - Exonic
1067283947 10:44894186-44894208 CCTCCTGACTCCCCTCCTTCTGG - Intergenic
1067720058 10:48721490-48721512 TCTCCTCCCTCCTCCCCTTCTGG + Intronic
1067723187 10:48745655-48745677 TCTCCTTCCTCTTCTCCTCCAGG + Intronic
1067780691 10:49204107-49204129 TACTCTCTATCCTCTCCTTCTGG + Intergenic
1068082367 10:52335354-52335376 TCTCCCCTGTCCACTCCCTCTGG - Intergenic
1068248196 10:54400835-54400857 CTTTCTCTCTCCTCTCCCTCTGG - Intronic
1068627203 10:59262457-59262479 GTTGCTCTCTTCTCTCCTTCAGG + Exonic
1069125061 10:64620029-64620051 TCCCTTTTCTCCTCTCCTTTTGG - Intergenic
1069313717 10:67071707-67071729 TGTATTCTCTCCTCTCCTTTGGG + Intronic
1069437846 10:68401647-68401669 GCTCCTATTTCCTCTGCTTCGGG + Exonic
1069824077 10:71244660-71244682 CCTCCTCCCTCCTCTCCTCTTGG - Intronic
1069923761 10:71833887-71833909 TCTCCTCACTCCTCTCAAACAGG - Intronic
1070244534 10:74718658-74718680 TTATCTCTCCCCTCTCCTTCAGG + Intergenic
1070598323 10:77848277-77848299 TCTCCTCTCTTCCTTCCTCCAGG + Intronic
1070892715 10:79953751-79953773 TTTTCTCTCTCTTCTACTTCTGG + Intronic
1070974523 10:80595729-80595751 ACTCCTCTGTCCTCTCCTCCTGG + Intronic
1071004718 10:80869595-80869617 TTTCCTTTCTCCTCTTCCTCAGG - Intergenic
1071223708 10:83500523-83500545 TCTATTCTCTCCTATTCTTCTGG - Intergenic
1071468467 10:85961787-85961809 TCTCCTTTTTCCCTTCCTTCAGG + Intronic
1071512865 10:86275821-86275843 TTATCTCTCTCTTCTCCTTCTGG - Intronic
1071579237 10:86755556-86755578 TCTCCTCTTTCCTCACATACGGG + Intergenic
1071844929 10:89512143-89512165 TCCCCTTTCTGCTCTCCGTCAGG - Intronic
1072199884 10:93149040-93149062 TTTCTTCTCTCCTCTTCATCTGG - Intergenic
1072469781 10:95702539-95702561 TTATCTCTCTCCTTTCCTTCTGG - Intergenic
1072497652 10:95978303-95978325 TTCCCACTCTTCTCTCCTTCAGG + Intronic
1073070171 10:100788352-100788374 TCTCTTCCCGGCTCTCCTTCTGG + Intronic
1073080776 10:100859333-100859355 CCTCTCCTCTCCTCTCCTTCTGG + Intergenic
1073231977 10:101979476-101979498 CTTCCTCTGTCCTCTCCCTCAGG - Intronic
1073400755 10:103255357-103255379 TTTTTCCTCTCCTCTCCTTCTGG + Intergenic
1073531011 10:104232099-104232121 CCTCCTCCCTCCTCTCCCTCCGG - Intronic
1073889980 10:108090410-108090432 TCTCCCCACTCCTCTCCTCAGGG - Intergenic
1073973538 10:109073361-109073383 TCTCCTGTGTCCTGTTCTTCCGG - Intergenic
1074098972 10:110338591-110338613 TCTCCTCTATCCTCTGCAGCTGG + Intergenic
1074196708 10:111194923-111194945 TTTTCTTTCTCTTCTCCTTCTGG + Intergenic
1074367769 10:112873620-112873642 CCTGCCCTCTCATCTCCTTCAGG - Intergenic
1074848661 10:117421098-117421120 TCTTATCTCTCATCTCCGTCAGG + Intergenic
1074973341 10:118560984-118561006 TCTTCTCTCTCCTGACCATCTGG + Intergenic
1075264845 10:120991347-120991369 CCTCCTCTGTCCTCTCTTTGGGG + Intergenic
1075491522 10:122875044-122875066 TCTTCTCTTTCTTCTACTTCTGG + Intronic
1075795858 10:125118950-125118972 TCTCCTATGTCCGCTCCTTCTGG - Intronic
1075826892 10:125365028-125365050 TCCTCTCTCTCCTCTCCTTCTGG - Intergenic
1075913575 10:126147285-126147307 TCTCCTCTCACCTGGGCTTCAGG + Intronic
1076138135 10:128058784-128058806 TCCCTTCTCTCCTCTCCCCCAGG - Intronic
1076173957 10:128350887-128350909 TCATCTCTCTCCTTTCCTTTGGG + Intergenic
1076205077 10:128591197-128591219 TTTCCTCTCTCCTGTCCATCAGG + Intergenic
1076304545 10:129455297-129455319 TCACCTCTCTCCTGACCTCCAGG - Intergenic
1076632127 10:131857619-131857641 TCTCCACGCTCCTCCCCGTCGGG + Intergenic
1076671388 10:132122653-132122675 TCTCCTGTCTTCCCTCCATCTGG - Intronic
1076717392 10:132373305-132373327 TCTGCTCTCGTCTCTCCTGCTGG - Intronic
1076732017 10:132443965-132443987 ACTCCTCTCCCCTCTCCTCAGGG + Intergenic
1076739194 10:132473601-132473623 TTTGCTCTCTCCTCTCCTTCTGG - Intergenic
1076911510 10:133392364-133392386 GCTCCTCTCTTCTCACCCTCTGG + Intronic
1077252874 11:1568321-1568343 CCTCCTCCCTCCCCTCCCTCTGG - Intronic
1077304770 11:1864135-1864157 TCTCCTCTCTCCTTTCCCTCTGG - Intronic
1077355916 11:2117181-2117203 TTTGCTCTCTCCTCCCCTTCTGG + Intergenic
1077387716 11:2279218-2279240 TCTCTTCTGTCCTTTCATTCAGG - Intergenic
1077407250 11:2388249-2388271 ACTCCTGTCTCCCCTCCTCCGGG - Intronic
1077520562 11:3031047-3031069 TTCCCTCTCTCCTCTCCTCTGGG - Intronic
1077814413 11:5671722-5671744 TTTCCTCTCTTCTTTCCTTCTGG - Intronic
1077930016 11:6721267-6721289 ACTCCTCTCTCTTCTCTGTCAGG + Intergenic
1078368867 11:10728782-10728804 TCTCTTTTCTCCTCTTTTTCAGG + Intergenic
1078750538 11:14157631-14157653 TATTCTTTCTCCTTTCCTTCTGG + Intronic
1078781286 11:14441532-14441554 TCTCCTTCCTCTTCTCCTCCAGG - Intergenic
1078784081 11:14470687-14470709 TCCTCTCTTTCCTCTCCTTTTGG - Intronic
1079109183 11:17594545-17594567 GCACCACTCTCATCTCCTTCAGG - Intronic
1079141958 11:17817036-17817058 TCTCTCCTCTCCTCTGCTGCTGG + Intronic
1079416460 11:20241986-20242008 TCTCCCACCTCCTTTCCTTCTGG + Intergenic
1080069005 11:28056498-28056520 TTTGCTCTCTCCTCTACTTCTGG - Intronic
1080184351 11:29462589-29462611 TCTTCTCTGTCCTCTCTTTGAGG + Intergenic
1080280428 11:30550632-30550654 TTTCCATTCTCCTCTCATTCCGG + Intronic
1080399256 11:31919061-31919083 CCCCCTCCCTCATCTCCTTCAGG - Intronic
1080412983 11:32043848-32043870 TTTCCTCTCTGCTTTCCTGCTGG - Intronic
1080563158 11:33483116-33483138 CTTCCTCTATCCTTTCCTTCTGG + Intergenic
1080634218 11:34109232-34109254 TCTCCTCCCTCACCTCTTTCAGG + Intronic
1080655127 11:34252559-34252581 TCCCTGCTCTCCTCTCTTTCAGG - Intronic
1080868093 11:36213211-36213233 TCTCCTCTCTCATTTCCCTCTGG + Intronic
1080978509 11:37371820-37371842 TTCCCTCTCTCCTCTCCTTCTGG - Intergenic
1081047179 11:38290709-38290731 TCTTTTCTCTCCTCTCCTCCTGG + Intergenic
1081156712 11:39702342-39702364 AACCCTCTCTCCTCTCCATCTGG + Intergenic
1081310687 11:41567963-41567985 TTTTTTCTCTCTTCTCCTTCTGG + Intergenic
1081479138 11:43467905-43467927 TGTTCTCTCTCCTCTTCTCCTGG - Intronic
1081647826 11:44802234-44802256 TCTGCTGTTTCCTCTCCTGCAGG - Intronic
1081981096 11:47267841-47267863 TTTCTTCTCTCCTCACCTTAGGG - Intronic
1082762294 11:57139001-57139023 TTCTCTCTCTCCTTTCCTTCTGG - Intergenic
1083143248 11:60738880-60738902 TCCTCTCCCTCCTCTCCTGCAGG + Exonic
1083206713 11:61154621-61154643 TTTTCTCTTTCCTCTCTTTCGGG - Intronic
1083282554 11:61636044-61636066 ACTCCTCCCTCCCCTCCTCCAGG - Intergenic
1083319878 11:61839042-61839064 TATCCACTCTCCTCCCCGTCCGG + Intronic
1083847568 11:65344978-65345000 TCTCCCCACTCCTTTCCTGCTGG + Intronic
1084079218 11:66808864-66808886 TCTCTTCTCTCTTCTCTTTTTGG - Intronic
1084099606 11:66937536-66937558 CCCTTTCTCTCCTCTCCTTCTGG + Intronic
1084229839 11:67743606-67743628 TTTTCTCTCTCCTCTTCTCCTGG + Intergenic
1084357068 11:68646513-68646535 TTTCTTCTCTCCTCTCCTTCTGG + Intergenic
1084485777 11:69447336-69447358 TCCCTTCTCTCCTCCCCTCCCGG - Intergenic
1084546371 11:69817107-69817129 TCCCCTCCCGCCTTTCCTTCTGG + Intronic
1084663453 11:70561119-70561141 TGTCTTCTCTTTTCTCCTTCTGG + Intronic
1085148400 11:74225381-74225403 TGTTCTCTCTCCTCTACTTCTGG + Intronic
1085240763 11:75052674-75052696 ACCTTTCTCTCCTCTCCTTCTGG + Intergenic
1085333149 11:75669215-75669237 GCTCCTCCCTCCTCTACTCCCGG + Intergenic
1085392605 11:76190069-76190091 TCCCCTCTCCCCTCCCCTCCCGG - Intronic
1085597232 11:77820957-77820979 CCCCTTCTCTCCTCCCCTTCGGG + Exonic
1085624580 11:78062131-78062153 CCTCCTCTCTCCTCTCCTGCAGG + Intronic
1085730439 11:78993460-78993482 TCATCTCTCTCTTCTCCTTGTGG + Intronic
1085882140 11:80480035-80480057 TCTCCTTTCTTCTCTCTCTCAGG + Intergenic
1085920498 11:80949697-80949719 TTCTCTCTCTCTTCTCCTTCTGG - Intergenic
1086326253 11:85703179-85703201 ACTATTTTCTCCTCTCCTTCTGG - Intronic
1086996364 11:93360829-93360851 CCATCTTTCTCCTCTCCTTCTGG - Intronic
1087092811 11:94292034-94292056 TTTTCTCTCTTCTCTCCTCCTGG - Intergenic
1087134171 11:94698027-94698049 CATTCTCTCTCCTCTCCTTTTGG - Intergenic
1087154946 11:94893229-94893251 TTTCCTATCTCTTCTCCCTCTGG + Intergenic
1087619293 11:100524073-100524095 TTGTCTCTCTCTTCTCCTTCTGG - Intergenic
1087699729 11:101422578-101422600 TTTCTTGTCTCCTCTCCTTCTGG + Intergenic
1088019355 11:105100750-105100772 ACTGCTTTCTCTTCTCCTTCAGG + Exonic
1088183481 11:107138192-107138214 GCTCCTCTCTTGTCTCCTTTTGG + Intergenic
1088499768 11:110472071-110472093 TTTTCTTTGTCCTCTCCTTCGGG + Intergenic
1088754966 11:112878216-112878238 TCTACTCTGTCCCTTCCTTCAGG + Intergenic
1088792793 11:113241025-113241047 TTTTCCCTCGCCTCTCCTTCAGG - Intronic
1088973863 11:114797381-114797403 TCTTCTATTTTCTCTCCTTCTGG + Intergenic
1089015788 11:115164127-115164149 TCTCTTCTCTCCCCTCTTACTGG - Intergenic
1089324758 11:117649555-117649577 CTGCATCTCTCCTCTCCTTCTGG + Intronic
1090453718 11:126829024-126829046 TCTCCAGCCTCCTGTCCTTCAGG - Intronic
1090847341 11:130541870-130541892 TCCCCAATGTCCTCTCCTTCTGG + Intergenic
1091231132 11:133988681-133988703 TCTCCTCTCCCCACTCCTCGGGG + Intergenic
1091338445 11:134792056-134792078 CCCCACCTCTCCTCTCCTTCAGG - Intergenic
1091381961 12:67432-67454 TCTCCTCTCCCCGCTCACTCAGG - Exonic
1091383096 12:75656-75678 TCTCATCTCCCATCCCCTTCAGG - Intronic
1091394014 12:142679-142701 CCTCCTTTCTCTTCTCCCTCCGG + Intronic
1091523570 12:1273069-1273091 TCCCCTCCCTCCCTTCCTTCTGG - Intronic
1091603700 12:1933486-1933508 ACAGCTCTCTCCTCTCCCTCGGG - Intergenic
1091758447 12:3071656-3071678 TCTCCTTCCTCTTCTCCTCCAGG + Intergenic
1091776778 12:3189782-3189804 TCTCTTCCCTCCTCCCCATCAGG - Intronic
1092200750 12:6581097-6581119 TCCACTTTCTCCTCTCCCTCAGG + Exonic
1092278619 12:7081939-7081961 TCTCCTCTCTCTCCTTTTTCTGG + Intronic
1092456201 12:8645055-8645077 GCTCCTCCCTTCTCTGCTTCAGG - Intronic
1092683801 12:11018171-11018193 TTTGCTTTCTCCTCTCCTACGGG - Intronic
1092688115 12:11073819-11073841 TTTGCTTTCTCCTCTCCTACGGG - Intronic
1092692623 12:11130663-11130685 TTTGCTCTCCCCTCTCCTACAGG - Intronic
1092866992 12:12770651-12770673 TATTCTCTTTCTTCTCCTTCTGG - Intronic
1093053040 12:14525446-14525468 TTTTCTCTCTCTTCTCCCTCTGG - Intronic
1093109901 12:15138259-15138281 TTTCCTATTTCCTCTCCTTCTGG + Intronic
1093383519 12:18522834-18522856 TTTTCTCTCTCCTCTCCTTTAGG + Intronic
1093799914 12:23361002-23361024 TCTCCTCCATCCTAGCCTTCTGG + Intergenic
1093967521 12:25342825-25342847 TTGCCTCACTCCTCTCTTTCTGG + Intergenic
1095566446 12:43629477-43629499 TTCTCTTTCTCCTCTCCTTCTGG + Intergenic
1095573673 12:43710373-43710395 TCTTCCCTCTCTTCTCCTTAAGG + Intergenic
1095902036 12:47338017-47338039 TTTCTCCTCTCCTCTCCTTCAGG + Intergenic
1096288776 12:50323393-50323415 TCCCTTCACTGCTCTCCTTCAGG - Intergenic
1096473932 12:51896571-51896593 TCTCCTCTCTCCTTTCCCACAGG + Intergenic
1096616889 12:52838320-52838342 TCTCCTCCTTCCTCTCCTTCAGG - Intronic
1096763712 12:53865514-53865536 TTTCCCCACTCCTCTCCTTGGGG - Intergenic
1096785217 12:54013383-54013405 CTTCCTTTCTCCTCTCCTTCAGG - Intronic
1097427498 12:59465031-59465053 TCTACTCTTTCACCTCCTTCTGG + Intergenic
1098671222 12:73233350-73233372 TTTCCTATATCTTCTCCTTCTGG - Intergenic
1098684751 12:73404543-73404565 TTTGCTATCTCTTCTCCTTCTGG - Intergenic
1098823156 12:75258981-75259003 TCTCTTCTCTTATCTCCTTGAGG + Intergenic
1099100948 12:78439704-78439726 TTTCCTCTCCTCTCTCCTCCAGG + Intergenic
1100029591 12:90169841-90169863 TCTACTCTGCCCTGTCCTTCAGG - Intergenic
1100300873 12:93306529-93306551 TCTTCTTTCTTCTCTTCTTCTGG - Intergenic
1100405594 12:94270489-94270511 TGGCCTCTTTCCTCCCCTTCTGG + Intronic
1100541271 12:95559754-95559776 TTTCCTCCTTCCTCTTCTTCTGG + Intergenic
1100794778 12:98170020-98170042 TTTGCTCTCTCTTTTCCTTCTGG - Intergenic
1100909977 12:99348241-99348263 TATTCTGTCTCCTCTCTTTCTGG - Intronic
1100953709 12:99882312-99882334 TACTCTCTCTTCTCTCCTTCTGG - Intronic
1100996542 12:100306977-100306999 TGTCCTCTCTTATTTCCTTCAGG - Intronic
1101199131 12:102416458-102416480 TCTGCCCTCTCTTTTCCTTCTGG + Intronic
1101247305 12:102896223-102896245 TCACCTCTCTCAACTCCTTTAGG - Intronic
1101544988 12:105704131-105704153 TCTCCTCCCTCATCCCTTTCTGG - Intergenic
1101664138 12:106794353-106794375 CTTTCTCTCTCCTCTCCTTCTGG - Intronic
1101850338 12:108396884-108396906 TCTCCTTCCTCCTTCCCTTCAGG - Intergenic
1101852792 12:108417678-108417700 TCTCCCCTCACCAGTCCTTCAGG + Intergenic
1101882367 12:108634174-108634196 TCTGGTCACTCCTGTCCTTCAGG - Intergenic
1102576577 12:113859610-113859632 TCCCTTCTCTCCTCTCCTCCAGG + Intronic
1102904359 12:116662761-116662783 TCTCCTTTCTCCTTGCCTTGCGG + Intergenic
1102981117 12:117242425-117242447 TCTCCTTTTTCCACTCCTTCAGG + Intronic
1102982850 12:117256071-117256093 TTCCCTCTCACCCCTCCTTCAGG - Intronic
1103176433 12:118867549-118867571 TCCACTCTCTCCTCTCATGCTGG - Intergenic
1103743740 12:123108367-123108389 TCTCCTGTCTCCTTTCTTACAGG - Intronic
1103937990 12:124486568-124486590 ACTCCTCTGTCCCCTCCTGCAGG - Exonic
1103954343 12:124567905-124567927 TCCCCTCCCTCTTCTCCTGCGGG + Intergenic
1104049381 12:125185901-125185923 TCTCCTCTCCCCTCTCCCACAGG + Intergenic
1104468083 12:129006094-129006116 CCACCTCTTACCTCTCCTTCCGG + Intergenic
1104689929 12:130818117-130818139 TCTCCTGTCCCCTCCCCTGCAGG - Intronic
1104715496 12:131013470-131013492 TCTCCCCCCACCTCGCCTTCTGG + Intronic
1105002945 12:132702862-132702884 CCGCCTCCCTCCTCTCCCTCGGG - Intronic
1105435512 13:20374135-20374157 CTCCCTCTGTCCTCTCCTTCTGG - Intergenic
1105466569 13:20647743-20647765 TTTCCTCTCTCTTCCCCTTTTGG - Intronic
1105560961 13:21490328-21490350 TCTGTTCTCTCCTCACCTTCAGG - Intergenic
1105846733 13:24300043-24300065 TTTGCTCTGTCCTCTCCTTCTGG + Intronic
1105940304 13:25141824-25141846 TCTCCTCTCCCCTGTCCTTGGGG + Intergenic
1106244167 13:27933126-27933148 TATCCACTCTCCTGTCCTTCTGG - Intergenic
1106253308 13:28000634-28000656 TCAGCTCTTTCTTCTCCTTCAGG - Intergenic
1106394579 13:29367620-29367642 TCTGCCCTCTCCTTTCCATCGGG - Intronic
1106480404 13:30133234-30133256 TCTCTTCTCTCCTGTCCTGGAGG + Intergenic
1106948106 13:34851407-34851429 TAACCTCTCTGCTCTACTTCAGG + Intergenic
1106995121 13:35471952-35471974 CGTCCTCTCGCCTCTCCTTGGGG + Intronic
1107067806 13:36234389-36234411 TTTTCTTTCCCCTCTCCTTCTGG - Intronic
1107557260 13:41527666-41527688 TTTCCTTTTGCCTCTCCTTCTGG - Intergenic
1107883192 13:44851676-44851698 ACTGATCCCTCCTCTCCTTCTGG + Intergenic
1108099300 13:46936800-46936822 TCTTCTCTCTCCTTTCCATAAGG - Intergenic
1108136980 13:47375113-47375135 TCTAATCTTTCCTTTCCTTCTGG + Intergenic
1108473678 13:50791578-50791600 TCTCCCCTCACCTCTCCACCAGG + Intronic
1108474537 13:50800779-50800801 TCGCCTCTCTCTTCTCCCTAAGG - Intronic
1108781370 13:53839876-53839898 TTTTCTCTCTCCTCTCATTCTGG + Intergenic
1109170913 13:59096162-59096184 TCTCCTCTCACATCTGGTTCAGG + Intergenic
1109258563 13:60114500-60114522 TCCACTCTCTCTTCTGCTTCTGG - Intronic
1109459838 13:62642114-62642136 TATTTTCTCTCCTTTCCTTCTGG - Intergenic
1109510655 13:63367850-63367872 TCTTCTCCCTCCTCACCCTCTGG - Intergenic
1109620754 13:64901378-64901400 TCTCCCCTCTCCTGTCCCTAGGG - Intergenic
1109627430 13:64993867-64993889 TCTCCTCTCTCCCCACCCACTGG + Intergenic
1109647253 13:65274662-65274684 TCTCTTCTCTGGTCTTCTTCAGG + Intergenic
1109938007 13:69318906-69318928 TTCACTCTCTCATCTCCTTCAGG + Intergenic
1110067415 13:71126179-71126201 TTTCTTTTCTTCTCTCCTTCTGG - Intergenic
1110446264 13:75585025-75585047 TTCCATCTCTCTTCTCCTTCTGG - Intronic
1111350622 13:87024362-87024384 TGTTCTTTCTCCTCTCTTTCTGG - Intergenic
1111350922 13:87030083-87030105 CCTTCTTTCTCCTTTCCTTCTGG - Intergenic
1111451022 13:88416277-88416299 TTTTCTCTTTCCTCTCATTCTGG + Intergenic
1111583685 13:90256877-90256899 CCTCCTCTCTCATCTCTTTTAGG + Intergenic
1111774148 13:92638127-92638149 TTTCCTCTCCCCTATCCTTTGGG - Intronic
1111929242 13:94496861-94496883 TCCTCTCTCTCCTCTGCTCCAGG - Intergenic
1112868145 13:103934032-103934054 CCTCCTCTCTTCCTTCCTTCTGG + Intergenic
1113137650 13:107111805-107111827 TCCCTTCTCTCCTGACCTTCAGG + Intergenic
1113233668 13:108243707-108243729 TCTTTTCTCTCCTCTCTTTCTGG - Intergenic
1113537273 13:111077758-111077780 TCCCCTCTCTTCTCTTTTTCCGG - Intergenic
1113556074 13:111236145-111236167 ATTTCTCTCTCCTCTCCTTCTGG + Intronic
1113677009 13:112214586-112214608 TCCCTTCCTTCCTCTCCTTCAGG - Intergenic
1113710695 13:112462618-112462640 TTCTCTTTCTCCTCTCCTTCTGG - Intergenic
1113725560 13:112597851-112597873 TTTTCTCTCTCCCCTCCTTCTGG - Intergenic
1113744915 13:112737520-112737542 CCCCTTCCCTCCTCTCCTTCTGG - Intronic
1113755414 13:112808018-112808040 GCTCTCCTCTCCTCTCCTCCAGG - Intronic
1113885950 13:113658475-113658497 CCCCTTCCCTCCTCTCCTTCAGG + Intergenic
1114202010 14:20530077-20530099 TTCCCTCTCTCCTCTCTTCCTGG + Intergenic
1114351776 14:21860782-21860804 TCTCCTCTCTATTCTCTTTCTGG - Intergenic
1114402609 14:22423554-22423576 TCTCCTCTCTTCTGTCCCACTGG - Intergenic
1114500782 14:23166696-23166718 GCTCCTCTTTCCCCTACTTCAGG - Intronic
1114557232 14:23568990-23569012 TCACTTCCCTTCTCTCCTTCAGG + Exonic
1114770103 14:25420491-25420513 TTTCCTAACTCCTCTCTTTCTGG + Intergenic
1114935229 14:27527758-27527780 TTTTCTCTTTCTTCTCCTTCTGG + Intergenic
1115130759 14:30049698-30049720 TCTCTTCTCTACTGTCCTTCAGG - Intronic
1115485235 14:33903438-33903460 GTTCCACTCTCCTCTTCTTCAGG - Intergenic
1115660634 14:35490942-35490964 TTTTCTCTATCTTCTCCTTCTGG + Intergenic
1115678976 14:35715155-35715177 TCTCCTTCATTCTCTCCTTCTGG + Intronic
1115916336 14:38319675-38319697 TCTGCTCTCTCTTCTCATTCTGG + Intergenic
1115985927 14:39103375-39103397 TCTCCTCCCTCCTCCCCTCTCGG - Exonic
1116029912 14:39558945-39558967 TTCTCTCTCTCCTCTCTTTCTGG + Intergenic
1116466271 14:45236271-45236293 TCTCCCTGTTCCTCTCCTTCAGG + Intronic
1116620763 14:47200700-47200722 TCTCCTTCCTCTTCTCCTGCAGG + Intronic
1116677844 14:47927902-47927924 TCTCTTGTCTCCTCTATTTCAGG + Intergenic
1116702737 14:48260945-48260967 TTTCCTCTATGTTCTCCTTCTGG - Intergenic
1117022095 14:51581257-51581279 TCTACTACCTCCTCTCCTTCAGG + Intronic
1117105802 14:52395832-52395854 TTCCCTCTCCCCTCTCCCTCCGG + Intergenic
1117237124 14:53790005-53790027 TCTCCTGTAGCCTCTTCTTCAGG + Intergenic
1117419445 14:55529787-55529809 TTTCCTCTCTACTTTCCTTTTGG - Intergenic
1117421894 14:55555030-55555052 TCTCGGCTCTACTCTTCTTCAGG + Intergenic
1117441776 14:55766645-55766667 TCTCCTTCCTCTTCTCCTCCAGG - Intergenic
1117842155 14:59870822-59870844 TCTCCCCCCTCCTCTTCCTCCGG + Exonic
1118015185 14:61653169-61653191 TTTTCTCTCTCATTTCCTTCAGG + Intronic
1118083755 14:62392653-62392675 TTTCCTATCTCTTATCCTTCTGG + Intergenic
1118551788 14:66959822-66959844 TTCTTTCTCTCCTCTCCTTCTGG + Intronic
1118896196 14:69947646-69947668 CCTCCTCTCTCTTCTCCTCTTGG + Intronic
1118931209 14:70242780-70242802 TGTCCTCTCTTCTTTCCTTGAGG + Intergenic
1119601274 14:75978911-75978933 TCTCCTCACACCTCTCCTGCCGG + Intronic
1119745247 14:77039201-77039223 TCACCAGGCTCCTCTCCTTCAGG + Intergenic
1119979675 14:79065666-79065688 TGTTCTCTCTCCTCTTCTTATGG + Intronic
1120014900 14:79461122-79461144 TCACCTTTCTCCCCTCCTTTTGG + Intronic
1120139143 14:80908278-80908300 TTCTCTCTCCCCTCTCCTTCTGG + Intronic
1120151992 14:81046603-81046625 TTTTCTCTCTCATTTCCTTCTGG - Intronic
1120219740 14:81718842-81718864 TCTCCTCTCTCCTTTGCTCTGGG + Intergenic
1120287558 14:82523210-82523232 TCTCCTCTCCCCTCCTCTCCAGG - Intergenic
1120327139 14:83044820-83044842 TCTTCTCTCTTACCTCCTTCGGG - Intergenic
1120344955 14:83275411-83275433 TTTTCTCTCTCACCTCCTTCAGG - Intergenic
1120469090 14:84899553-84899575 TTTCCTCTCTCTTCTCCTCCTGG - Intergenic
1120473058 14:84951230-84951252 TCTCATTTCTCTTCTCCTCCAGG - Intergenic
1120779567 14:88474702-88474724 TCTCTTCTGTCCTATCCTCCTGG - Intronic
1121007714 14:90500928-90500950 CCTGCTGTCTCCTCTGCTTCCGG - Intergenic
1121166922 14:91810935-91810957 TCCCCTCTCTTTTCTGCTTCTGG - Intronic
1121182575 14:91940616-91940638 TCTCCTCTCTCCTTCCCTGCAGG - Exonic
1121385019 14:93512487-93512509 TCTGTTTTCTCCTCTCATTCTGG + Intronic
1121712507 14:96049679-96049701 TCTTCTCTCTCCTCTTCTTTTGG + Intronic
1121713505 14:96056387-96056409 TCACCACTCTCCTCTCCCTAAGG - Intronic
1122063987 14:99159052-99159074 TTTGTGCTCTCCTCTCCTTCAGG - Intergenic
1122079468 14:99256937-99256959 TCTCCCCTCTCCTTTCTCTCTGG - Intronic
1122377858 14:101278569-101278591 CCTTCTTTCTCCTCTCATTCTGG - Intergenic
1122541750 14:102501872-102501894 TCCCATCTCACCTCTGCTTCCGG - Exonic
1122708155 14:103634622-103634644 TCTCCTCCCTCCTCTTCTCTTGG - Intronic
1122799113 14:104221048-104221070 TTTCCTTCCTCCTCTCCCTCTGG - Intergenic
1124063715 15:26319941-26319963 TCTCAAGTCTCCTCTCATTCTGG - Intergenic
1124172158 15:27385466-27385488 TCGCGTCTCTCCTCTCGTTCTGG + Intronic
1124173095 15:27395053-27395075 TCCCCTCTGCCCTCTCCTTCTGG + Intronic
1124440215 15:29680287-29680309 TTTCCCCTCTCCGCTCCTCCTGG - Intergenic
1124643286 15:31413276-31413298 TCCTTTCTCTCCTCTCCTTCTGG - Intronic
1124654163 15:31495140-31495162 TCTCTTCTCTCCAGGCCTTCAGG + Intronic
1124719126 15:32096968-32096990 TCTACACTCCCCTCTCCCTCTGG - Intronic
1125082405 15:35690522-35690544 TTTCTTCCCTCCTCTCTTTCTGG - Intergenic
1125231187 15:37458152-37458174 TTTCTTCTCTCCTCTCCTCAGGG - Intergenic
1125301670 15:38260925-38260947 TCTCCTCTATTCTCTTCTTTTGG - Intronic
1125518044 15:40333861-40333883 TCCCCTCTGCCCCCTCCTTCTGG - Exonic
1125550513 15:40541164-40541186 CCTCCTCTCTCCTCTGCGTGAGG + Intronic
1125599886 15:40909701-40909723 TGCCCTGTCTCCTTTCCTTCAGG - Intergenic
1126477016 15:49076249-49076271 TCTCATCTCTCTTCTTCCTCAGG + Intergenic
1126705183 15:51399414-51399436 CCTCCTCCCTCCTCTCCCTCAGG + Intronic
1127140331 15:55969517-55969539 TCTACTCTTACCTCTCCTCCTGG - Intronic
1127313678 15:57774912-57774934 TCACCTTTCTCCTCTCCTCCAGG + Intronic
1127392559 15:58518520-58518542 TGTTCTCGCTCCACTCCTTCAGG + Intronic
1128073356 15:64810961-64810983 TCTCCTCTCCACTCTCCCACAGG - Intergenic
1128262854 15:66244556-66244578 GTTCCTCACTCCTCTCCTGCTGG + Intronic
1128364376 15:66986964-66986986 TCTCCTCCCTCCCATTCTTCTGG + Intergenic
1128404834 15:67325012-67325034 TTCTCTCCCTCCTCTCCTTCTGG + Intronic
1128647073 15:69385576-69385598 CCTCTTCTCTCCTCCCCTTGTGG + Intronic
1128780484 15:70355755-70355777 TCTCCTCTCTTGTCTCCTCTGGG - Intergenic
1129082590 15:73053074-73053096 TCGCCTCTCTCCCCTCCCCCAGG + Intronic
1129372026 15:75103317-75103339 TTCCCTCTCTTCTCTCCTTAAGG + Intronic
1129493555 15:75954068-75954090 TCCTCTCTCTTATCTCCTTCAGG + Intronic
1129667197 15:77585963-77585985 TCTCTTCCCTCCCCTCCTTCAGG - Intergenic
1129824867 15:78628402-78628424 TTTCCTCTCTCCTCTGCCTCAGG + Intronic
1129908262 15:79205173-79205195 TCTCCTCCCTGGTCTCCATCCGG - Intergenic
1130039954 15:80398006-80398028 TTTCCCCTCTCCTTCCCTTCAGG - Exonic
1130205290 15:81869888-81869910 TCCCTTCTCTTTTCTCCTTCAGG + Intergenic
1130777086 15:86995576-86995598 TCTCCTCTGTGCCTTCCTTCTGG - Intronic
1130848899 15:87774376-87774398 TTTCTCCTCTCATCTCCTTCAGG - Intergenic
1130878179 15:88032256-88032278 TCTCATCTCCCCTCTCCTGTTGG - Intronic
1131482223 15:92792055-92792077 GTTCCTGTCTCCTCTCCTTCTGG - Intronic
1131577542 15:93606695-93606717 TGTGCTGTCTCCTCTGCTTCAGG + Intergenic
1132267921 15:100493627-100493649 TTTATTCTCTTCTCTCCTTCTGG + Intronic
1132289939 15:100692920-100692942 TCTCCTCTTAGCTCTCCTTTGGG + Intergenic
1132685021 16:1158625-1158647 TCTCCTCCCTCCTCCCCAGCGGG - Intronic
1132746796 16:1439541-1439563 TCCCCCCTCCCCTCCCCTTCAGG - Intronic
1132837406 16:1961056-1961078 TCTCCTCTCTCCCCTCCAAAGGG + Intronic
1134060392 16:11196181-11196203 CCTCCTCTTTCCTCTCTCTCAGG + Intergenic
1134354848 16:13472283-13472305 TCTCCTCTGTCCCCTCATTTGGG + Intergenic
1134556916 16:15173415-15173437 CAGCCTCTCTCCTCTCCTTGAGG + Intergenic
1134886483 16:17797687-17797709 TCTGCTCTCTCCTCTCCCACAGG + Intergenic
1134892713 16:17855123-17855145 TCTCATCTCACCTCTCATTGTGG - Intergenic
1134917495 16:18085133-18085155 CAGCCTCTCTCCTCTCCTTGAGG + Intergenic
1135293796 16:21262217-21262239 TCACCTCTCTCCTGTGCTTTGGG - Intronic
1135296906 16:21287584-21287606 TCTCCTGTCTCCTTCCCTCCTGG - Intronic
1135715162 16:24758432-24758454 TCTTCTCTCTCCCATCCTTGAGG - Intronic
1136010321 16:27359317-27359339 TCTCCTTCCTCCACTCCTTCTGG - Intronic
1136138009 16:28269462-28269484 TCTCCTCTCTACTGTCTTTCTGG - Intergenic
1136281196 16:29212395-29212417 TCCCCTCCTTCCTCTCCTCCTGG - Intergenic
1136381730 16:29899233-29899255 TCTCCTCTGTCCTCTTCTCGCGG + Exonic
1136396124 16:29993507-29993529 CCTCCTCCCTCTGCTCCTTCAGG + Exonic
1136403077 16:30028993-30029015 TCTCCCTTGTCCTCTCCCTCAGG + Intronic
1136502897 16:30682394-30682416 TCTCCTCTCCCTTTTTCTTCAGG - Intergenic
1136909095 16:34132162-34132184 TCTCCTGTCTCCTCACACTCTGG + Intergenic
1137696561 16:50465781-50465803 TCCTCTCTGTCCTCTGCTTCCGG - Intergenic
1137710352 16:50562714-50562736 CCTCCTCTCTCCTTTCCTTCAGG - Intronic
1137908684 16:52353296-52353318 TACTCTCTTTCCTCTCCTTCTGG + Intergenic
1138601525 16:58057816-58057838 TTGCCTCTCTCCTCAGCTTCAGG + Intergenic
1138712366 16:58983882-58983904 TTTTCTCTCTATTCTCCTTCAGG - Intergenic
1139951296 16:70672424-70672446 TTTTCTCTCTCCTGTCCTGCTGG - Intronic
1140037710 16:71383751-71383773 GCTCCTCTCTCCCCTCCTCAGGG - Intronic
1140542344 16:75768884-75768906 ACATTTCTCTCCTCTCCTTCTGG + Intergenic
1140649424 16:77070832-77070854 CATTCCCTCTCCTCTCCTTCTGG - Intergenic
1140891830 16:79291331-79291353 GAACTTCTCTCCTCTCCTTCAGG + Intergenic
1141657217 16:85422666-85422688 TCTCTCCTCTCGCCTCCTTCAGG - Intergenic
1141679963 16:85538120-85538142 TCTCTTCTCCCCTCCCCTTCTGG - Intergenic
1141797943 16:86287176-86287198 TCTGCGCTCTCCTCTTCTCCAGG + Intergenic
1142085560 16:88178318-88178340 TCCCCTCCTTCCTCTCCTCCCGG - Intergenic
1142124240 16:88402276-88402298 CCTACTCTACCCTCTCCTTCAGG + Intergenic
1142175186 16:88642003-88642025 GCTCCTTCCTCCTCCCCTTCAGG - Intergenic
1142694033 17:1623595-1623617 CCACTTCTCTCCTCTCCTCCAGG + Intronic
1142836983 17:2594243-2594265 TGCCCTCGCTCCTCTCCTCCCGG + Intronic
1142929697 17:3272485-3272507 GTTTCTCTCTCTTCTCCTTCTGG - Intergenic
1142994719 17:3753812-3753834 TGGCCTCTCTGCCCTCCTTCTGG + Exonic
1143015141 17:3887634-3887656 TGTCCTCTCTCACCTCCTCCAGG - Intronic
1143468227 17:7153031-7153053 TCTCCCCTCTCCCCTCCTTCTGG - Intergenic
1143672310 17:8405227-8405249 TCTCTTCTCTCCACTGCTTCTGG - Intergenic
1143866670 17:9928644-9928666 TGACTTCTCTCCTCTCCCTCAGG + Intronic
1144021867 17:11245027-11245049 TTTCATCTCTCTACTCCTTCAGG + Intronic
1144346449 17:14354038-14354060 TCTCCACTAATCTCTCCTTCTGG + Intergenic
1144395701 17:14840994-14841016 CCTCCTTTCTCCTCTTCTCCAGG - Intergenic
1144454561 17:15408254-15408276 TCTCCACTCCCCTCTCCCCCAGG - Intergenic
1144499684 17:15774975-15774997 TCCCCTCTCTTTTCTTCTTCTGG + Intergenic
1144999676 17:19295264-19295286 TCTCCTCTCTCCTCACCTGAGGG + Intronic
1145015144 17:19391696-19391718 TCTCTTCTCCCATCTCCTGCTGG - Intergenic
1145058441 17:19717685-19717707 TGTCCTGCCTCCTCTCCTTCAGG - Intronic
1145123534 17:20281691-20281713 TCTGCTGGCTCCTCTCCTCCTGG - Intronic
1145749060 17:27342189-27342211 TCTGGTCTCCCCTCTGCTTCTGG + Intergenic
1145765520 17:27456277-27456299 CCTCCTCTCCCCTCCCCTCCCGG - Intergenic
1146108478 17:30064560-30064582 TTTCCCTTCTCTTCTCCTTCTGG - Intronic
1146807487 17:35876582-35876604 TCCTGTCTCTCCTTTCCTTCAGG + Intronic
1146836419 17:36114423-36114445 TCCCTTCACTGCTCTCCTTCAGG - Intergenic
1147186387 17:38715590-38715612 CTTCCTCTCTCCTCTCCTTCAGG + Exonic
1147238947 17:39077877-39077899 CCTCCTCTCTGCTCCCCTCCTGG + Intronic
1147381437 17:40058522-40058544 CCTCCTCTCCTCTCTCCTGCTGG + Intronic
1147502384 17:40978026-40978048 TTTACTATTTCCTCTCCTTCCGG - Exonic
1147544104 17:41386629-41386651 TTCTCTCTCTCTTCTCCTTCTGG + Intronic
1147577769 17:41612512-41612534 TCTCCTCTCGCTTCTCCTCTGGG - Exonic
1147595209 17:41712398-41712420 TAGCCTCTCCCCTCTCCTCCTGG - Intronic
1147924733 17:43939237-43939259 TCTCACCTCTGCTCTCCCTCTGG - Intergenic
1148162076 17:45455962-45455984 TCTCCTCTCTCCTGCCACTCTGG + Intronic
1148183196 17:45620958-45620980 TCTCGCCTCTCCGCTCCCTCTGG + Intergenic
1148265654 17:46224733-46224755 TCTCGCCTCTCCGCTCCCTCTGG - Intronic
1148466869 17:47870327-47870349 TCATCTCCCTCCTCTGCTTCAGG + Intergenic
1148881081 17:50727661-50727683 TCTTCTCTCTCCTCTCCCTCAGG - Intronic
1149082934 17:52679625-52679647 TTTCCCTTCTCTTCTCCTTCTGG - Intergenic
1149145546 17:53487942-53487964 TCTCCTGGCTCATCTCCTTCAGG + Intergenic
1149307328 17:55361266-55361288 TTCTCTCTCTCCTCTCCTTTTGG - Intergenic
1149478493 17:56983291-56983313 TCTCAGTTCTCCTCTGCTTCTGG - Intronic
1149509007 17:57221922-57221944 TCCCATCTGTCTTCTCCTTCAGG - Intergenic
1149559321 17:57596846-57596868 TCTTCTCTCTCTTTTCCTTTAGG + Exonic
1149629218 17:58107643-58107665 TCTCTCCTTTCCTGTCCTTCAGG + Intergenic
1149911995 17:60575268-60575290 TTCTCTCTCTCCTCTCCTTCTGG + Intronic
1150028169 17:61700744-61700766 TTTTTTCTCTCCTCTCCTTCTGG + Intronic
1150393309 17:64802610-64802632 TCTCCTCTCTCCTGCCACTCTGG + Intergenic
1150420442 17:65029346-65029368 TCTGCTTCCACCTCTCCTTCTGG + Intronic
1150484513 17:65534408-65534430 TCTCTTCTCTCATCTTCTTGAGG - Intronic
1150692597 17:67378328-67378350 TCCCCTCCCTCCTCTCCTCCAGG - Intronic
1151267702 17:72969340-72969362 TCTCCTCTCTCCCCTGAATCTGG - Intronic
1151323821 17:73366882-73366904 TCTACTCTCTCCCCTCCACCAGG + Intronic
1151497261 17:74466333-74466355 ACTCCTCCCTCCTTTCCTTGTGG - Intergenic
1151651843 17:75475089-75475111 TCCCCTCTCTCCTGTCCCTGAGG - Intronic
1151948051 17:77330112-77330134 CCTCCTGCCTCCTCTCCTTCGGG + Intronic
1152286780 17:79417178-79417200 TATCTTCTCTCCTCTCCCCCAGG - Intronic
1152343851 17:79739802-79739824 TCTTCTCAGTCCACTCCTTCTGG - Intronic
1152531741 17:80922943-80922965 TCTCCTCCCCCCTCTCCAGCGGG + Intronic
1153370831 18:4314035-4314057 TCTCCTCTCTCCACTCTTGTGGG - Intronic
1153520099 18:5943623-5943645 TGTCCTCTCATCTCTCCTTGAGG - Intergenic
1153544258 18:6189924-6189946 TTTTCTATCTCCTCTCCTTATGG - Intronic
1154041969 18:10865013-10865035 TCTCCTCACTCTTGTCCTTCTGG - Intronic
1154051978 18:10969733-10969755 TCCCCTCACTCCTCTCCTACAGG - Intronic
1154171223 18:12052609-12052631 ATACCTCTCTCCTTTCCTTCTGG + Intergenic
1154405175 18:14084224-14084246 TTTCTTCTCTCTCCTCCTTCAGG + Intronic
1155303795 18:24458849-24458871 TTTCCTTTCTCCTTTCCTCCTGG + Intergenic
1155916107 18:31558647-31558669 TCTCCTCCCTTCTCACCTTTTGG - Intergenic
1156018882 18:32577329-32577351 TGTCCTCTCTCCTGTCTTTCTGG + Intergenic
1156423526 18:36982187-36982209 TCTGCTCACAACTCTCCTTCAGG - Intronic
1156428423 18:37042835-37042857 TTATCTCTCTCCTCTTCTTCTGG + Intronic
1156545843 18:37962895-37962917 GCTCCTCTCTCCTTTCTTCCCGG + Intergenic
1156638754 18:39063983-39064005 TCTCTTCACTACTTTCCTTCGGG + Intergenic
1156788428 18:40943490-40943512 TCTCCCATCTCCTCTGCTGCAGG - Intergenic
1156908654 18:42384894-42384916 TTTCCTCCCTTCCCTCCTTCTGG + Intergenic
1157051181 18:44167166-44167188 CCTCCTCCCTCCACACCTTCTGG - Intergenic
1157189457 18:45568375-45568397 GCTGCTCTCTCCTTGCCTTCAGG + Intronic
1157248832 18:46076132-46076154 TCTGCTCTCTCCTATCTCTCAGG - Intergenic
1157308854 18:46536914-46536936 GCTCCTGGCTCTTCTCCTTCAGG + Intronic
1157627235 18:49060859-49060881 ACACTTCTCTCCTCTCCATCAGG - Intronic
1157935948 18:51873612-51873634 TCCCCTTTCCCCTCTCCTTAGGG + Intergenic
1158219424 18:55134933-55134955 TCTCCTCTGTTCTCTCCTTGAGG + Intergenic
1158886193 18:61829475-61829497 TCCCCTCTCTCCTCTCTCCCTGG - Intronic
1158911226 18:62064851-62064873 TCTCTTCTCTCCTCTCCCTCTGG - Intronic
1159169577 18:64747995-64748017 ACTCCTATCTGCTCTCCCTCTGG - Intergenic
1159237161 18:65691609-65691631 TTTCATCTCTCTTCTCCTTTTGG + Intergenic
1159286810 18:66363933-66363955 GCCTCTTTCTCCTCTCCTTCTGG - Intergenic
1159711360 18:71764557-71764579 TCCCTTCACTCTTCTCCTTCGGG - Intronic
1159779875 18:72648736-72648758 TCTCTTCTCTACTCTCCAACAGG + Intergenic
1159877130 18:73825273-73825295 TCTGCTCTCTTCTCTCCATAAGG - Intergenic
1160038771 18:75324642-75324664 TATACTCTCCCCTTTCCTTCTGG + Intergenic
1160346564 18:78137192-78137214 ACTGCTCTCTCCTCTCTTTTTGG + Intergenic
1160410697 18:78673679-78673701 TATCCTCACTGTTCTCCTTCTGG - Intergenic
1160415662 18:78708772-78708794 TTCTCTCTCTTCTCTCCTTCTGG + Intergenic
1160593928 18:79961570-79961592 ACGCCTCTCTCCTCTCCAGCCGG - Intergenic
1161028315 19:2046691-2046713 TCTCCTCTCCTCTCCCCTGCAGG - Exonic
1161110164 19:2464790-2464812 TATTCTCTCTCCCCTCCTGCTGG - Intergenic
1161438290 19:4277143-4277165 TCTCCCCACTCCCCTCCTTGGGG + Intergenic
1161730309 19:5956430-5956452 TCTGCTATCTCCTCTCCCTTGGG - Intronic
1161757307 19:6143648-6143670 TCTCCACTCCCCCCTGCTTCAGG + Intronic
1162516194 19:11149280-11149302 CCTTCTCTCTGCTCTCCTTGGGG - Intronic
1162833241 19:13299755-13299777 GCTCCTCCCTCACCTCCTTCAGG + Intronic
1162857391 19:13479347-13479369 GCTTCTCCCTCCTCTCCTTCAGG - Intronic
1163292430 19:16387971-16387993 TTTTCTCTCCCCTCTCTTTCTGG - Intronic
1163328801 19:16622785-16622807 TCCCCACTATCATCTCCTTCTGG - Intronic
1163424991 19:17236187-17236209 TCTCCAATCTCCTCTCCTCCCGG - Intronic
1164544222 19:29145658-29145680 TCTGCTTTCTTCCCTCCTTCTGG - Intergenic
1164567989 19:29342614-29342636 TTTTCTTTCTTCTCTCCTTCTGG - Intergenic
1164607528 19:29610828-29610850 TGGCCTCTCTCCTCACCTTCAGG + Intronic
1164732723 19:30518485-30518507 TATCCTCTGACTTCTCCTTCGGG - Intronic
1164753582 19:30673373-30673395 TCTCTGCTCTCCTCTCCCTGGGG + Intronic
1164921497 19:32092002-32092024 TCACCTTCCACCTCTCCTTCTGG + Intergenic
1165157386 19:33796637-33796659 TCTCCTCCCTCCTCTCTCTCCGG - Intronic
1165345145 19:35241722-35241744 TTTTCTCTCTCTTCTCCTTCTGG - Intergenic
1165379110 19:35465346-35465368 TTTTCTCTCTTCTCTCCTTCTGG + Intergenic
1166063415 19:40341890-40341912 TCTCTCCTCTCTTCTCTTTCAGG - Exonic
1166265656 19:41682666-41682688 TCTGCTCCCTGCTCTGCTTCCGG - Intronic
1166329189 19:42069045-42069067 CCTCTTCTCACCTCTTCTTCTGG - Intronic
1166424381 19:42662855-42662877 TCTGCTCTCTGCTCTGCTTCAGG + Intronic
1166436249 19:42768271-42768293 TCTCTTCTCTCCTCCCTGTCTGG + Intronic
1166668242 19:44694406-44694428 CCTCCTCTGTCGCCTCCTTCAGG + Intergenic
1166943208 19:46380957-46380979 TTTCTGCTCTCCTCTCCGTCTGG + Intronic
1167135219 19:47611531-47611553 GCTTCTCTCTTCTCTACTTCAGG - Intronic
1167220894 19:48197297-48197319 TGTCCTCTCTCCTCCATTTCCGG - Exonic
1167295222 19:48645685-48645707 GCTCCTCTGTCCCCTCCTTCTGG + Exonic
1167959809 19:53096720-53096742 TCTCCTTTCTCCCCTCCCTCAGG - Intronic
1168114979 19:54217377-54217399 TCTCCTCCCTCCTCACTGTCTGG - Exonic
1168308140 19:55447183-55447205 CCTCCTTTCTCCCTTCCTTCAGG + Intergenic
924994242 2:342345-342367 TTTCCTCTGCCTTCTCCTTCTGG - Intergenic
925014627 2:513202-513224 TCATCTCTCTCTTCCCCTTCTGG + Intergenic
925227394 2:2195946-2195968 GCTCCTCTTGCCTCTCCTTATGG - Intronic
925437303 2:3850817-3850839 TTTTCTCTCTTCTCTCCTTCTGG - Intergenic
925450855 2:3968288-3968310 TCTCCTCTCCCCTCTTCTCAAGG - Intergenic
925557767 2:5151304-5151326 TCCGCTCTCTTTTCTCCTTCTGG + Intergenic
925569967 2:5299245-5299267 TTTCCCCTGTCCTCTCTTTCTGG + Intergenic
925579615 2:5397243-5397265 TCTTCTCTCTGATCTCCTACAGG + Intergenic
925703624 2:6663206-6663228 TTTCCTCCCTCCTCTCCTTCAGG - Intergenic
925784760 2:7421196-7421218 TCTCATCTCTCCTTTCCTTCAGG - Intergenic
925899636 2:8499688-8499710 TTTCCTCTCTCCTGTTCTTTTGG - Intergenic
926094137 2:10070185-10070207 GCTCCCGTCTCCTCACCTTCCGG + Intronic
926103814 2:10137783-10137805 TCTTCCCTCTCCTCTACTTCAGG + Intergenic
926523249 2:13943747-13943769 TCTTCTCTCTCTTCTTCATCAGG + Intergenic
926646046 2:15290762-15290784 TCTCTTCTCCTCTGTCCTTCTGG - Intronic
926762649 2:16292367-16292389 CCTCATCTGTCCCCTCCTTCTGG + Intergenic
927008775 2:18880158-18880180 TCTCTTCACTACTGTCCTTCAGG - Intergenic
927073613 2:19554661-19554683 TCTGCTCTCCCCCATCCTTCTGG - Intergenic
927656036 2:24947275-24947297 TGTCCTCTCTTCCCTCCTCCAGG + Exonic
927899702 2:26810563-26810585 TCTCCTCTCCCACCTTCTTCTGG - Intergenic
928231278 2:29500762-29500784 TCCCTTCGCTCTTCTCCTTCAGG + Intronic
928324286 2:30307469-30307491 TCTCCTCACAGCTCTCCCTCTGG - Intronic
928767924 2:34670414-34670436 TCTCTTCTCTCCTTTCCTGGAGG - Intergenic
929065259 2:37966507-37966529 CTTTCTCTCTCTTCTCCTTCTGG + Intronic
929465629 2:42141319-42141341 TCTCCTCCCTGCTCCCCTGCTGG - Intergenic
929954741 2:46448115-46448137 CTCCCTCTCTCCTCTCCTTTGGG + Intronic
929996129 2:46827228-46827250 TCTCCTCAGTCCTCACCCTCTGG + Intronic
930155206 2:48099855-48099877 TCCTCTTTCTCCTCTCCTTCTGG - Intergenic
930477728 2:51904716-51904738 TTGTCTCTCTCTTCTCCTTCTGG - Intergenic
930536548 2:52651830-52651852 TCCCCTCACCACTCTCCTTCAGG + Intergenic
930538087 2:52668683-52668705 TCTCCTTCCTACTCTCCTCCTGG - Intergenic
930626594 2:53705666-53705688 TGCCCAATCTCCTCTCCTTCTGG + Intronic
931201621 2:60103256-60103278 TCTCCTCTGTCCCCTCCATCTGG + Intergenic
931315571 2:61127774-61127796 TTCTCTCTCTCCTCTCCTTTTGG - Intronic
932258205 2:70304759-70304781 TCTCCTCTCTTCTCTCACTCAGG + Intergenic
932292575 2:70594871-70594893 TCCCCCCTCTCCTCTTCTCCAGG - Intergenic
932342321 2:70973844-70973866 TTTTCTCTCATCTCTCCTTCTGG + Intronic
932490263 2:72115749-72115771 ACTCCTCTCTCTCCTCCTCCTGG + Intergenic
932805783 2:74781878-74781900 TTTTCTCTCTCATCTCTTTCTGG + Intergenic
932859350 2:75273616-75273638 TTTTTTCTCTCATCTCCTTCAGG + Intergenic
933130273 2:78663840-78663862 CCTCGTCTCTTCTCTCCTTTAGG + Intergenic
933193866 2:79367354-79367376 TCTTTTCTCTCACCTCCTTCAGG - Intronic
933641604 2:84767716-84767738 TCTGCACTCTTCTCTCCTTCTGG - Intronic
934042680 2:88142088-88142110 CTTTCTCTCTCCTCTCCTTTGGG + Intergenic
934213783 2:90009616-90009638 TCTACTCTCTCCTCCCATTGGGG - Intergenic
934541164 2:95176202-95176224 TCTCCTGTGTGCTCTCCTTGTGG - Exonic
934726402 2:96622867-96622889 CTCCCTCTCTCATCTCCTTCAGG + Intronic
934873073 2:97885877-97885899 TCTCCTTTCTCTTCTCCTTCTGG + Intronic
934932525 2:98439327-98439349 TTATCTCCCTCCTCTCCTTCTGG + Intergenic
934965804 2:98720845-98720867 CTTTCTCTCTCCTTTCCTTCTGG - Intronic
934982533 2:98856017-98856039 TTTTCTCTGTCCTCTCCTTTGGG - Intronic
935073929 2:99721871-99721893 TTTTGTCTCTCCTCTCCTCCTGG + Intronic
935079497 2:99778241-99778263 TCTCATCTCTTATCTCCTTCAGG + Intronic
935475292 2:103513594-103513616 TCTCCATTCTCCTCTTTTTCTGG + Intergenic
935483407 2:103621634-103621656 TTTTCTCTCTTTTCTCCTTCAGG - Intergenic
935884478 2:107601781-107601803 TTTTCTCTCTCTTCTCTTTCTGG + Intergenic
936240883 2:110787693-110787715 GTTCCACTCTCCTCTTCTTCTGG + Intronic
936471880 2:112805950-112805972 TCACCTCTTTCCCCTCCTTCTGG - Intergenic
936475999 2:112840379-112840401 TCTCCTTTCCCTTCTGCTTCTGG + Intergenic
936529512 2:113266101-113266123 GAACCTCTCTCCTCTCCTCCTGG - Intronic
936579191 2:113681831-113681853 TTTCTGCTCTCCTCCCCTTCAGG - Intergenic
936601805 2:113903823-113903845 ACTACACTCTCTTCTCCTTCTGG + Intronic
936706513 2:115081218-115081240 TCCAGTCTCTCCTCTCCATCTGG + Intronic
936740112 2:115495129-115495151 TCGCCTTAATCCTCTCCTTCTGG - Intronic
936770129 2:115902505-115902527 TCTCTTCTCTTCTCTTTTTCTGG + Intergenic
936891855 2:117379752-117379774 TCATTTCTCTCCTCTTCTTCTGG + Intergenic
937169185 2:119848506-119848528 TTCCTTCTCTCCTCTCCTTCTGG + Intronic
937230019 2:120392561-120392583 CCTCCTCTCACCCCTCCTGCAGG - Intergenic
937512458 2:122611504-122611526 TCTTCCCTCTCCTCTCCTGAAGG - Intergenic
938048677 2:128147126-128147148 TCTCTTCCCTCCTCTCATTCTGG + Intronic
938064597 2:128274154-128274176 TTTTCTCTCTCCCCTCTTTCTGG - Intronic
938091456 2:128437316-128437338 CCTCCACTCTCCCCTCCTCCAGG - Intergenic
938321371 2:130367863-130367885 CCCCCTTTCTCCTTTCCTTCTGG + Intronic
938757813 2:134396943-134396965 TCTCCTCCCTCCTTTTCTTCTGG - Intronic
938778166 2:134560095-134560117 CCTGCTCCCTCCCCTCCTTCAGG + Intronic
939103408 2:137921918-137921940 TCTCCTCTCTTCTCTCTTCAGGG - Intergenic
939450488 2:142367256-142367278 TCTTGTCTCTCATCTGCTTCTGG + Intergenic
939474768 2:142673501-142673523 TTTCTTCTCTCCCCTCCTTCAGG + Intergenic
939587750 2:144025845-144025867 TGCCTTCTCCCCTCTCCTTCAGG - Intronic
939877830 2:147598128-147598150 TCTCCCCTCACCTCTCTTTCTGG + Intergenic
939910180 2:147972926-147972948 TTTCCTCTCTTCTCTCCCTCTGG + Intronic
939983258 2:148805798-148805820 CCTCTCCTCTCTTCTCCTTCTGG + Intergenic
940322211 2:152389611-152389633 TGTGCTCTCTCCACTACTTCGGG - Intronic
940322959 2:152396696-152396718 TCTCCCCTCTCCCCTCCTCAAGG + Intronic
940342285 2:152593997-152594019 TCTCTTCACTCTTTTCCTTCTGG - Intronic
940392116 2:153144252-153144274 TCTCCATTCTCCTTTCCTTCAGG - Intergenic
940451738 2:153845662-153845684 CATTCTCTTTCCTCTCCTTCTGG - Intergenic
940529131 2:154857518-154857540 TCTCCTCCCCACTCTCCTTCTGG - Exonic
941116848 2:161481521-161481543 TTTCCCTTCTCTTCTCCTTCTGG - Intronic
941141104 2:161782893-161782915 TTCCTTCTCTCTTCTCCTTCTGG - Intronic
941549297 2:166894970-166894992 TCTTCTCTCTCCTGTTCTGCTGG - Intronic
941913774 2:170793948-170793970 TATCCTCTCTCTTCTCTTCCTGG + Intronic
941932503 2:170956122-170956144 TCTCCTCTTTCCTCACCACCTGG - Intronic
942498697 2:176565633-176565655 TCACCTCTCCCCTCTGCTCCTGG + Intergenic
942722919 2:178972711-178972733 TCTCCTGACTTCTCTCCTTGGGG - Intronic
943501966 2:188702648-188702670 TCTCATTTCTCATCTCATTCAGG - Intergenic
943721767 2:191211563-191211585 CCATGTCTCTCCTCTCCTTCTGG + Intergenic
944366126 2:198921581-198921603 TTTACTTTCTCCTCTCCTTCTGG - Intergenic
944598189 2:201281811-201281833 TCTCCTTTCTCATTTGCTTCAGG + Intronic
944924071 2:204445329-204445351 TTTTCTCTCTCCTTTCCTTCTGG - Intergenic
945321640 2:208431023-208431045 TTTATTCTCTCATCTCCTTCTGG + Intronic
945747011 2:213730762-213730784 TCTGTTCTCTCTTCTTCTTCAGG + Intronic
945914752 2:215691444-215691466 TCTCCTCTCCCCTCTGCCCCTGG - Intergenic
946193124 2:218017954-218017976 ACTCCTGGCTCCTCTCCCTCAGG - Intergenic
946194673 2:218025945-218025967 TTTCCTCTCTCCTTCCCTTGGGG + Intergenic
946247631 2:218396579-218396601 TCCCATCTCTTCTCTCCTTGAGG - Exonic
946281971 2:218672239-218672261 TCTCCACCCGCCTCTCCCTCCGG - Exonic
946303199 2:218838114-218838136 TCCTCTCTCTACTCTCCTTCTGG - Intergenic
946410839 2:219514466-219514488 TCTCCTCGATCGTCTCCTTGTGG - Exonic
946465165 2:219905302-219905324 TCATCTCTCCCCTCTTCTTCTGG - Intergenic
947167901 2:227281034-227281056 TCTCATGTCTCCTGCCCTTCTGG - Intronic
947300487 2:228683667-228683689 TCACTTCTCTCCTCTCCCTCAGG - Intergenic
947393337 2:229662605-229662627 TCTCCTCCCTCATGGCCTTCAGG + Intronic
947567379 2:231203140-231203162 TCTCCTCTCTCCTCTTTCTTTGG + Intronic
947697257 2:232202073-232202095 TGTCCTTTGTCCTCTGCTTCAGG + Intronic
947758079 2:232583190-232583212 TCTTCACTCTCCTCACATTCTGG - Intronic
947907404 2:233775454-233775476 TTTCCTCTTCCCTCTCCTCCGGG + Intergenic
947953875 2:234171091-234171113 TCCCTTCTCTCCACTCCTCCAGG - Intergenic
948173941 2:235928586-235928608 TCTCCGCCCTGCTCTCCTCCTGG - Intronic
948197310 2:236105511-236105533 TCTCCTCTCTCCTCCACATGAGG - Intronic
948318812 2:237052677-237052699 TCTCCTCTCTGTTCTTCTTGTGG - Intergenic
948383467 2:237567217-237567239 CCCACCCTCTCCTCTCCTTCGGG + Intergenic
948543625 2:238708786-238708808 TTTTCTCTCTTCTCTTCTTCTGG + Intergenic
948774615 2:240277466-240277488 TCTCCCCTCTCCTCTCCTCAAGG - Intergenic
948823777 2:240564490-240564512 TCTGCTCCGTCCTCTCCCTCTGG + Intronic
949079693 2:242087195-242087217 TCCCCTCTTTCCCCTCCTACCGG + Intergenic
1169156630 20:3336326-3336348 TCTTCGTTCTCCTCTCCTTCTGG + Intronic
1169623299 20:7532675-7532697 TTTTCTCTCTCTTCTCTTTCTGG + Intergenic
1169662756 20:7998501-7998523 TCTCCAATCTCCTCTCCTAAGGG + Intronic
1169968100 20:11239328-11239350 TCTCCTCTGTTCTCTTCTCCAGG + Intergenic
1170200680 20:13740555-13740577 TCTTCTCTGTTTTCTCCTTCTGG - Intronic
1170269394 20:14507244-14507266 TATTCTCTTTCCTCTCTTTCTGG + Intronic
1170706932 20:18752284-18752306 TCTGTTCTCTCTTCTCCTTTTGG + Intronic
1170718503 20:18853388-18853410 TCCTCTCTCTCGTCTCCTTTTGG + Intergenic
1170810884 20:19673394-19673416 TCTCTTCTCTCCTCACCTAAAGG - Intronic
1170945007 20:20883492-20883514 AGTTTTCTCTCCTCTCCTTCAGG - Intergenic
1170949001 20:20917676-20917698 TTTTCTCTCTCCACTCCTTCTGG - Intergenic
1171150842 20:22825392-22825414 TCTCCTTCCTCCACTCCCTCAGG + Intergenic
1171245865 20:23608922-23608944 ACTCCTCCCTCCCCTCCTCCAGG + Intergenic
1171382489 20:24744107-24744129 TATCCTCTTTCCCCTCCTCCTGG + Intergenic
1171813901 20:29765772-29765794 TCTCCTGTCTCCTCACACTCTGG - Intergenic
1171904554 20:30890932-30890954 TCTCCTGTCTCCTCACACTCTGG + Intergenic
1172178078 20:32984690-32984712 TCTCCAAACCCCTCTCCTTCAGG + Intronic
1172292631 20:33787476-33787498 TTTCCTCTCTGTTCTCCCTCTGG - Intronic
1172350742 20:34238237-34238259 TTTTTTCTCTCTTCTCCTTCTGG + Intronic
1172363838 20:34333853-34333875 TCTCCCCTCACCATTCCTTCAGG + Intergenic
1173192993 20:40890408-40890430 CCTCCTGTCTCCTCTGCTGCTGG - Intergenic
1173260790 20:41433159-41433181 TCCTCTTTCTCCTCGCCTTCTGG - Intronic
1173377143 20:42496162-42496184 TCTTCTTTCTCCTCTTCCTCAGG - Intronic
1173529102 20:43754891-43754913 CTCCCTCTCTCCCCTCCTTCCGG + Intergenic
1174115361 20:48223247-48223269 TCTCCTCCCTCATGTCCCTCAGG + Intergenic
1174317713 20:49715210-49715232 TCTCCCCTCCCCACTGCTTCTGG - Intergenic
1174904656 20:54537723-54537745 ATGTCTCTCTCCTCTCCTTCTGG - Intronic
1175254882 20:57635623-57635645 TTTTCTCTTTCATCTCCTTCTGG - Intergenic
1175469818 20:59219518-59219540 TCTCCCCTCTCCGCTCCAGCAGG - Intronic
1175570709 20:60019312-60019334 TTTCCATTCTCTTCTCCTTCTGG + Intronic
1176176091 20:63725702-63725724 GCCCCTCTCTCATCTCCTTTTGG + Intronic
1176282087 20:64319103-64319125 TCTCATCTCCCATCCCCTTCAGG + Intergenic
1176631215 21:9139716-9139738 TGTCCTCTCTCATTTCCTTGAGG + Intergenic
1176693771 21:9949298-9949320 CCTCCTCTGTCCTCTCTTTGTGG - Intergenic
1177215862 21:18127908-18127930 TTCTCTGTCTCCTCTCCTTCAGG - Intronic
1177408097 21:20696536-20696558 CTTTCTCTCTCCTTTCCTTCTGG - Intergenic
1178022593 21:28426959-28426981 TCTACTCCCTCCCCTCCTGCAGG - Intergenic
1178056793 21:28808070-28808092 TCTCCTCTCTCTTCATCTTGGGG - Intergenic
1178270058 21:31181480-31181502 CTTCCTCTCCCCGCTCCTTCTGG - Intronic
1178304711 21:31481869-31481891 GCCCCTCTCTCCTCTCCCTAAGG + Intronic
1178363413 21:31968602-31968624 CCTCCACTCACCTCTCCTCCAGG - Intronic
1179356387 21:40664446-40664468 CCTCCTCTTTCCTCTCCTGTCGG - Intronic
1179379247 21:40883236-40883258 TCTCCTCTCTTCTCTTCTTGTGG + Intergenic
1179582887 21:42355235-42355257 TTTTTTCTCTCCTCTCCTACTGG - Intergenic
1179609735 21:42542382-42542404 TCTCCTTTGGCCTCTCCTGCAGG + Exonic
1179958555 21:44755121-44755143 TTTTCTCTCCCCTTTCCTTCCGG - Intergenic
1180051526 21:45333694-45333716 TCTCCTCCCTCCCCACCCTCTGG + Intergenic
1180080676 21:45486314-45486336 TCTCTTCTCCCCTCGCCTGCCGG + Intronic
1180317354 22:11286395-11286417 TCTCCTGTCTCCTCACACTCTGG - Intergenic
1180337975 22:11597069-11597091 TCTCCTGTCTCCTCACACTCTGG + Intergenic
1180756133 22:18162875-18162897 TCTTCTCACTCTCCTCCTTCTGG + Intronic
1180923179 22:19533084-19533106 CCCCCTTTCTCCTCTCCTTTTGG - Intergenic
1180939512 22:19648352-19648374 TTTCTCCTCTCCTTTCCTTCTGG - Intergenic
1181075633 22:20374535-20374557 TCTTCTCACTCTCCTCCTTCTGG - Intronic
1181485503 22:23228951-23228973 TTCCATCTCTCCTCTCTTTCTGG + Intronic
1181587594 22:23862088-23862110 TCTCCTCTCTCCTCAGATTCAGG + Exonic
1182488522 22:30654326-30654348 TCTCCTTCCTCTTCTCCTCCAGG + Intronic
1182580378 22:31305525-31305547 TTTCCTTTCTCCTCACCCTCTGG + Intergenic
1182880872 22:33732295-33732317 TGGCCTCCCTCCTTTCCTTCTGG + Intronic
1183086464 22:35490204-35490226 TCTGCTCTGTCCTGTCTTTCAGG + Intergenic
1183191578 22:36324951-36324973 TGTCCTGTCTCCTGTCTTTCAGG + Intronic
1183778600 22:39984153-39984175 TATTCTCTCTTCTCTCCTCCAGG + Intergenic
1184120168 22:42444828-42444850 CCCCCTCTCTCCTCTCCCACGGG - Intergenic
1184392136 22:44209750-44209772 TCTCCATTCTCCCCTCCCTCAGG + Intronic
1184589944 22:45475430-45475452 TCTCCTCTCTGCCCTCCTCTGGG - Intergenic
1184623578 22:45703501-45703523 TGTTCTCTCTCCACTTCTTCTGG + Intronic
1184671961 22:46017776-46017798 ATGTCTCTCTCCTCTCCTTCTGG + Intergenic
1184698143 22:46150843-46150865 TGTCCTCGCTCCTCGCCCTCAGG - Intronic
1185038464 22:48491368-48491390 TCCTCTCTCTCCTCTCCTCTGGG - Intronic
1185188082 22:49415051-49415073 CATCCTCTCTCCCCACCTTCTGG + Intronic
1185299573 22:50072424-50072446 TCAGCGCTCTCCTCTCCTCCTGG + Intronic
949302442 3:2600146-2600168 ACTACTCTCTCCTCTCTTTCTGG + Intronic
949635008 3:5973217-5973239 TCCCTTCTCTCCTCTCCCCCAGG - Intergenic
949765078 3:7517165-7517187 TGTCCTGTTTCCTCTCCTCCTGG + Intronic
949873569 3:8609144-8609166 TCTCCTGTATCCTCTCCTGGTGG + Intergenic
950186176 3:10947047-10947069 TCTCCCCTCCCATCTCCCTCTGG - Intergenic
950207677 3:11093113-11093135 TCACAGCTCTTCTCTCCTTCTGG - Intergenic
950232708 3:11290524-11290546 TCTCCTTCCTCTTCTCCTCCAGG + Intronic
950453799 3:13080538-13080560 TCTCTCCTCTCTTCTCCTGCAGG - Intergenic
950478458 3:13228909-13228931 TCTCCTCTCTTTTCTCCTCCTGG + Intergenic
950634119 3:14303185-14303207 TCTGCTGTCGCCGCTCCTTCTGG + Intergenic
950649719 3:14399711-14399733 TCTCCTCCTTTCTCTCCTTGGGG + Intergenic
950931992 3:16799270-16799292 TGTCCAGACTCCTCTCCTTCAGG - Intergenic
951133755 3:19078769-19078791 TCTCCTCTCTCCATACCATCAGG - Intergenic
951456918 3:22903056-22903078 TCTCCTCTCTCCTTCCCTAGAGG - Intergenic
951558552 3:23945005-23945027 CCTCCTCTTTCCTCTCCTCCCGG - Intronic
951709904 3:25576869-25576891 TCTCCTCTCTTCTCTTCTGTTGG + Intronic
951747157 3:25991860-25991882 TTTTTTCTCTCCTCTTCTTCTGG - Intergenic
952180345 3:30910309-30910331 GCTCCACCCTCTTCTCCTTCAGG + Intergenic
952196484 3:31080971-31080993 TCGCCTCCCTTCTCACCTTCAGG + Intergenic
952367514 3:32687887-32687909 TGTCCTTTCTCTTCTCCGTCTGG + Intronic
952416972 3:33097971-33097993 ACTCCTTTCTCCTTTCCTACCGG + Intergenic
952720519 3:36527642-36527664 TGTTCTCTCTTCTTTCCTTCTGG - Intronic
952829587 3:37553684-37553706 CCACCTCTCTCCTCTGCTCCTGG + Intronic
952852637 3:37741468-37741490 TCTCCACTCTCCAGTCCTACTGG + Intronic
953251971 3:41252700-41252722 TATTCTCTGTCCTCTCATTCTGG - Intronic
953407972 3:42669162-42669184 TTCCAGCTCTCCTCTCCTTCCGG - Intergenic
953447032 3:42977206-42977228 TTTGCTCCCTCATCTCCTTCAGG - Intronic
953454172 3:43029066-43029088 TCTACTGTCTCCTCCCCTCCAGG + Intronic
953541790 3:43826167-43826189 TGTCTTCTCTCCGCTCCTTGTGG + Intergenic
953820703 3:46205296-46205318 CCTGCACTTTCCTCTCCTTCAGG - Intronic
954039607 3:47874969-47874991 CCTCCACTATCCTCTCCTCCTGG + Intronic
954396554 3:50296344-50296366 TCACCTCTCACCTCTTCTGCAGG - Intronic
954481110 3:50802880-50802902 TTTCCCTTCTCTTCTCCTTCTGG + Intronic
955036290 3:55271230-55271252 TCTCCTGTCTCCTATCCCCCCGG + Intergenic
955073613 3:55592390-55592412 TCCCCTCTGCCCTCTCCTTCTGG + Intronic
955335789 3:58084764-58084786 TCTCCCCTCTCCTCTGCTCCTGG + Intronic
955386797 3:58487083-58487105 CCTCCCCTCTCCTCTCTCTCTGG - Intergenic
956247324 3:67198338-67198360 TCTCCTCTTTCATCTACTTTTGG + Intergenic
956546155 3:70405741-70405763 TCTACTCTACCCTCTCCTTCCGG - Intergenic
956843521 3:73161373-73161395 TCTCCTCCCTCCTGCCCTCCTGG + Intergenic
957046408 3:75378453-75378475 TTTTCTCTCTCCTCTTCTCCTGG + Intergenic
957340326 3:78887613-78887635 ACTCTTCACTCCTCTCCTCCAGG - Intronic
957462459 3:80539000-80539022 TGTGGTCTCTCCTCTCCTTCTGG - Intergenic
957717145 3:83942734-83942756 TCTCCTCTCTCCTCCTCTAGTGG + Intergenic
957898390 3:86453331-86453353 CTTCCTTTCTCCTCTCCTTATGG - Intergenic
958258948 3:91356298-91356320 TCTCTTCACTGCTGTCCTTCAGG + Intergenic
958438153 3:94123142-94123164 TCTCCCTTCTCCCTTCCTTCTGG + Intronic
958722360 3:97859908-97859930 TCACCTCCTTCCTTTCCTTCTGG + Intronic
958855707 3:99382415-99382437 TTTTCTCTTCCCTCTCCTTCTGG - Intergenic
958956183 3:100467693-100467715 CCTCCTCTGTCCTCTCTTTGTGG + Intergenic
959329628 3:104987044-104987066 TCTTCTCTGTCCACTCCTTCAGG - Intergenic
960708507 3:120504594-120504616 CCTCCTCTCTCCTGCCCTTCAGG + Intergenic
960946583 3:122970982-122971004 TCTCCCCTCTCCAAGCCTTCTGG - Intronic
961070549 3:123920291-123920313 TTTTCTCTCTCTTCTCCTTCAGG - Intronic
961113520 3:124306536-124306558 TCCTCTCTCTCCTCTCCTTTTGG - Intronic
961130648 3:124463777-124463799 ACTCCTCTCTCTTCACCTCCTGG + Intronic
961172718 3:124809579-124809601 GCTCCTCTCTCTCCTCCTCCTGG + Intronic
961493902 3:127276628-127276650 CCTCCTCTGTCCTCTCTTCCAGG + Intergenic
961736545 3:129005299-129005321 TCTCTTCTCCTCTCTCCATCTGG - Intronic
961786239 3:129348730-129348752 TCTCCTCTGTTTTCTCCTCCTGG - Intergenic
961878473 3:130042691-130042713 TTTTCTCTCTCCTCTTCTCCTGG + Intergenic
961912332 3:130331053-130331075 TTTTCTCTCTCTTCTCCTTCTGG - Intergenic
961946706 3:130698296-130698318 TTTTCTCTCTCCTCTCCTACTGG + Intronic
962307155 3:134299120-134299142 CCTTCTCTCTTCTCTCCTCCAGG - Intergenic
962476806 3:135762190-135762212 TCTCCTCTGTCCTCTCAATATGG + Intergenic
962545675 3:136432005-136432027 ATTCCTCTCTCCTTTCCTTCTGG + Intronic
962547949 3:136456550-136456572 TTTTCTCTCTCGTCTCCTTTGGG - Intronic
962732936 3:138299800-138299822 TCCCCTCTCTCCCCTGCTTTGGG + Intronic
963025626 3:140916264-140916286 ACTTCTCACTCCACTCCTTCAGG - Intergenic
963511571 3:146254256-146254278 ATTTCTCTCTCTTCTCCTTCTGG + Intergenic
963757890 3:149255224-149255246 TTTCCCCTCTTCTCTCCATCTGG - Intergenic
963924585 3:150938107-150938129 TCTCCTCCCTACTCACATTCAGG - Intronic
964293996 3:155213466-155213488 TCTTCTCTTTCCTCTGCATCTGG + Intergenic
964467747 3:157016130-157016152 TCTTCTGTCTCTTGTCCTTCAGG - Intronic
965046379 3:163583966-163583988 ACTCTTCTCTTCTCTCCTCCTGG - Intergenic
965306598 3:167071551-167071573 TCCATTCTCTCTTCTCCTTCTGG - Intergenic
965317297 3:167208414-167208436 TCTCCTCTCTCTTCTCCTCAAGG - Intergenic
965504602 3:169499139-169499161 TCTCTTCTGTCCTTTCCTTCTGG - Intronic
965604029 3:170482184-170482206 TCTCCTCTCCCCTCTCCTCCTGG + Intronic
966395022 3:179493616-179493638 TTTCCTCTCTCTTCTCATTCTGG - Intergenic
966724843 3:183099786-183099808 TCTTCGCTCTCGTCACCTTCTGG + Intronic
967201440 3:187075810-187075832 GCTCCTCACTCTTCTCCATCAGG + Exonic
967346258 3:188459325-188459347 TTTCCTCTCTCCTGTTTTTCTGG - Intronic
967884353 3:194322956-194322978 TATCCTCTCTCCCCTCCCTGAGG - Intergenic
968383615 4:116499-116521 TCCTCTTTCTCCTCTCCTTTGGG + Intergenic
968483760 4:849008-849030 ACTCCTCTCTCCTCTCCACTTGG - Intergenic
968714759 4:2148340-2148362 CCTTTTCTCTCCTCTCCATCAGG - Intronic
968990692 4:3909566-3909588 TTTTCTCTCTCCTCTTCTCCTGG + Intergenic
969199172 4:5588492-5588514 TTTTCTCTCTCCTCTTCTCCAGG + Intronic
969267482 4:6074031-6074053 TCTCCTCCAACCTCTCCTTTGGG + Intronic
969416921 4:7067082-7067104 TCACCTGCCTGCTCTCCTTCAGG + Intronic
969582561 4:8073569-8073591 TCTCCTCTCTCCCCTTCTCCTGG - Intronic
969637557 4:8378097-8378119 TCTCCTCTCTCCTGTGCTGAAGG - Intronic
969824645 4:9747776-9747798 TTTTCTCTCTCCTCTTCTCCTGG - Intergenic
969828936 4:9780335-9780357 TCTGGTCTCTCCTCATCTTCTGG - Intronic
970223640 4:13835324-13835346 TCCCCTCTCTCCACTCTTTCAGG - Intergenic
970376763 4:15466327-15466349 CTTTCTCTCTCCTCTCCTTCTGG + Intergenic
970624097 4:17858394-17858416 TCTCCTCTCTCCTCTCCTTCTGG - Intronic
971084586 4:23257514-23257536 TTTACTCTCTCTTCTCCTTCAGG - Intergenic
971088492 4:23309956-23309978 TCTCCTCTATTCTCTTCATCTGG + Intergenic
971248758 4:24954067-24954089 CTTTCTCTCTCTTCTCCTTCTGG - Intronic
971395522 4:26223554-26223576 TCTTCACTCTTCTCTGCTTCTGG - Intronic
971857590 4:32062398-32062420 TCTCCTCACCACTGTCCTTCAGG + Intergenic
972247800 4:37263704-37263726 TCCCCTCCCTCTTCTCTTTCTGG - Intronic
972726405 4:41749699-41749721 TCTCCTCTTTCATCTCTTTCGGG + Intergenic
972902417 4:43700971-43700993 TCTTCCCTCTCCTCTCCTCAAGG + Intergenic
973289569 4:48457117-48457139 TTCTCTCTCTCATCTCCTTCTGG - Intergenic
973754994 4:54065437-54065459 TCTCCTCTGCCCTTTCTTTCAGG - Intronic
973815710 4:54617109-54617131 TCTCTTCTTTCCTCTGTTTCAGG - Intergenic
973829543 4:54744756-54744778 TCTTATTTCTCTTCTCCTTCTGG + Intergenic
973877803 4:55238866-55238888 TTTGCTCTCTCTTCCCCTTCTGG + Intergenic
973945891 4:55955403-55955425 TCTCCTCTCCCCTCAACTTCAGG - Intronic
974055635 4:56980023-56980045 TCTCCTCTCTCTATTCCCTCAGG + Intronic
974305884 4:60139655-60139677 ATTCCTCTTTCCTCTGCTTCTGG + Intergenic
974589102 4:63920127-63920149 TAGGCTCTTTCCTCTCCTTCTGG + Intergenic
975126309 4:70786234-70786256 TCCCCTGCCTCCTCTCCCTCTGG - Intronic
975367194 4:73543869-73543891 TCTCCTTTCTCTTTTCCTCCAGG - Intergenic
975375102 4:73633928-73633950 TTTGCTGTCTCTTCTCCTTCAGG - Intergenic
975773103 4:77751440-77751462 CATCCTTTCTCCTGTCCTTCTGG - Intronic
975852306 4:78584863-78584885 TCTCCTCTCTCCTCTCATAGGGG - Intronic
976107932 4:81639587-81639609 CCTCCACTCCCCTCTCCTCCTGG - Intronic
976118500 4:81754285-81754307 TCTCCTCCCTCTACTCCTGCAGG - Intronic
976167164 4:82268332-82268354 AGTCCTCTCTCCCATCCTTCAGG + Intergenic
976214030 4:82698732-82698754 CCTCTACCCTCCTCTCCTTCAGG + Intronic
976390365 4:84499236-84499258 TCTCCTTTCCTCTCTCCCTCCGG + Intergenic
976418468 4:84808358-84808380 TCTTCTCTCCCCTCTCCTTGGGG - Exonic
976571130 4:86612470-86612492 CTTTCTCTCTCCTCTACTTCAGG - Intronic
977030940 4:91882418-91882440 TTCTCTCTCTCCTTTCCTTCTGG + Intergenic
977179768 4:93858791-93858813 TTTCCCTTCTCTTCTCCTTCTGG - Intergenic
978612977 4:110565094-110565116 CCTCCTCCTTCCTCTACTTCAGG + Exonic
978906787 4:114014597-114014619 TCTTCTGTCTCCTTTCCTTCAGG + Intergenic
978966908 4:114751377-114751399 TCTCTTCACTGCTGTCCTTCAGG - Intergenic
979111093 4:116758276-116758298 TCTTCTCTCACCTCTCATTAGGG - Intergenic
979615026 4:122732859-122732881 GCTCCTTTCTCCTCTCCTACAGG - Exonic
979801286 4:124912646-124912668 TCTTCTCTCTCTTCTCCTTTGGG + Intergenic
980152027 4:129059946-129059968 TTTCCCTTCTCTTCTCCTTCTGG + Intronic
980199858 4:129642020-129642042 TCTCCCATCTCCTCAGCTTCTGG - Intergenic
980213542 4:129821301-129821323 TCACCTCTTCCCTCTCCTACTGG - Intergenic
980366385 4:131809494-131809516 CCTCCTCTGTCCTCTCTTTGTGG - Intergenic
980591824 4:134900013-134900035 TCTGCTCTCTCATTTCCTCCTGG + Intergenic
980742497 4:136970698-136970720 CTTCCTCTCTTCTTTCCTTCTGG + Intergenic
980820974 4:138017138-138017160 TCCCCATTCTCCTCTCCTTCTGG + Intergenic
980859860 4:138486252-138486274 ACTCCTCTTTCCTCTCCCTCAGG + Intergenic
981121501 4:141056571-141056593 TCTCCTTTCTCCTCTGCTTGAGG + Intronic
981595572 4:146417947-146417969 TCTCCTCTCTCTCCTCCCTGGGG + Intronic
982316381 4:154036120-154036142 TCTCTTCCCTTCTCTCCTTTGGG - Intergenic
982842044 4:160201231-160201253 TCTCATCTCTCTTCTTCCTCGGG - Intergenic
982935925 4:161475346-161475368 TTCTCTCTCTCTTCTCCTTCTGG + Intronic
983253622 4:165374255-165374277 TTGTCTCTCTCTTCTCCTTCTGG + Intronic
983519854 4:168696858-168696880 GCTTCTTTCTTCTCTCCTTCTGG - Intronic
983885341 4:172975019-172975041 TTCCCTCTCTTCTCTCCTTCTGG + Intronic
984213296 4:176877112-176877134 TCTACTTTTTCCTCTCCTTTTGG - Intergenic
984376772 4:178941142-178941164 TTTCCTTTCTCTTCTCCTTCTGG - Intergenic
984722198 4:182984528-182984550 TCCTCTCTATCTTCTCCTTCTGG - Intergenic
984816830 4:183846369-183846391 TTTTCTCTCTCCTCTCTTTGTGG + Intergenic
985783143 5:1881277-1881299 TCTCCTCCCTTCTCCCCTCCTGG - Intronic
985998306 5:3610189-3610211 TTTCCTCATGCCTCTCCTTCTGG - Intergenic
986051521 5:4094615-4094637 TCTCAGCTCTCCTCTCTCTCCGG - Intergenic
986211709 5:5679583-5679605 TCTCCTCTGTCCACTCTCTCTGG - Intergenic
986345125 5:6827581-6827603 TCTCCCATCTTCCCTCCTTCAGG - Intergenic
986624019 5:9706745-9706767 CTTCCTCTCTGCTCTCCGTCGGG - Intronic
986640359 5:9865983-9866005 TTTTCTTTCTCCTCTCTTTCTGG + Intergenic
987143101 5:14965360-14965382 CCTTCTTTCTCCTCTCCTTCTGG + Intergenic
987163299 5:15167725-15167747 CATCCTTTCTCCTCTCCATCTGG + Intergenic
987747399 5:21994006-21994028 TATCCTCTCTCCACTATTTCTGG + Intronic
987817744 5:22925368-22925390 ACACCTATCTCCTCCCCTTCAGG + Intergenic
987977683 5:25035758-25035780 TCTCCTCATTTCTCTCATTCTGG + Intergenic
988079168 5:26394267-26394289 CCTTCTCACTCCTCTCCTTCTGG - Intergenic
988372894 5:30395187-30395209 TCCTCACTCTCTTCTCCTTCTGG + Intergenic
988638437 5:33014168-33014190 TTTTCTCTCTCCCTTCCTTCTGG + Intergenic
988650482 5:33143711-33143733 TTTTCTCTCTCTTCTCCTTCTGG - Intergenic
988706068 5:33727070-33727092 TCTCCTCTCACCTCTCCTGGAGG + Intronic
988723257 5:33900248-33900270 TCTCTCCTCTCTTTTCCTTCAGG + Intergenic
988931649 5:36040896-36040918 TCTTCCCTCTCCTCTCCTGGAGG - Intronic
990315670 5:54581104-54581126 TCTCCAATCTCATCTCCTACAGG - Intergenic
990565641 5:57025461-57025483 TTTCCTCTCTCCTTCCCTTCAGG - Intergenic
990926168 5:61026239-61026261 TCTCCCCCCTCCTCCCCTGCAGG - Intronic
991394138 5:66185736-66185758 TCTCCTGTCTCCCCCTCTTCAGG + Intergenic
991767573 5:70003799-70003821 TATCCTCTCTCCACTATTTCTGG + Intergenic
991846807 5:70878875-70878897 TATCCTCTCTCCACTATTTCTGG + Intergenic
992240560 5:74765534-74765556 TTTCCTCCCTCATCTACTTCAGG - Intronic
992279467 5:75159279-75159301 TTTTCTCTCTCCTGTCTTTCTGG - Intronic
992823152 5:80518774-80518796 TCTCTTGTCTCCACTCCTTTTGG - Intronic
992923706 5:81557439-81557461 TTATCTCTCTCCTCTCCTTTGGG + Intronic
993475036 5:88354307-88354329 TTATCTCCCTCCTCTCCTTCTGG + Intergenic
994719909 5:103368523-103368545 TTTTCTCTCCCCTCTCCTCCTGG + Intergenic
994753382 5:103765428-103765450 TCAGCACTCTCATCTCCTTCAGG - Intergenic
994956438 5:106539110-106539132 TCTTCTCTTTCTTCTCCTTCAGG + Intergenic
995278630 5:110307674-110307696 TCTTCTCTCTCCTCTCCTCAAGG + Intronic
995388855 5:111616802-111616824 TCTTCTCTCTCCTCTCTGTGAGG + Intergenic
995436769 5:112144895-112144917 TCCCCTCCCTCTTCTCCTGCAGG - Intronic
996848894 5:127931172-127931194 TCTCTTCCTTCCTCTCCCTCTGG + Intergenic
997491530 5:134280965-134280987 TTTTCTCTCTCCTCTTCTTATGG + Intergenic
997854489 5:137361102-137361124 TCTCCTCTCTTCTCTACGTGAGG + Intronic
997888815 5:137657312-137657334 TCTCCTCCCACCTTTCCTCCTGG + Intronic
998186335 5:139982659-139982681 TCTTCTCTCTCTTCTGCCTCAGG + Intronic
998396182 5:141819841-141819863 TCTCATCTCCCCTCTCCTCCTGG + Intergenic
998422113 5:141997268-141997290 TCTATTCTCTCTTCTCCTTCTGG - Intronic
998494464 5:142575499-142575521 CCTCCTCTCTCCTCTTCCTCTGG + Intergenic
998949790 5:147381786-147381808 TTTTCTCTCTCTTCTCCTCCTGG + Intronic
999432583 5:151536880-151536902 TGTCCTCTCTCCTCCCTCTCTGG + Intronic
999736107 5:154514575-154514597 TCTCCTCTCTCTCCTCCACCTGG + Intergenic
999774240 5:154799569-154799591 TCTTCCTTCTCCTCCCCTTCAGG + Exonic
1000685221 5:164239968-164239990 TCCTTGCTCTCCTCTCCTTCTGG - Intergenic
1001282152 5:170394130-170394152 TCTCCTCTGTCCTTGCCTCCTGG + Intronic
1001738574 5:174029100-174029122 TTTCCTTTCTCCTCTTTTTCTGG - Intergenic
1001966105 5:175911020-175911042 TCTCCTCTCCCCTCTCCCTGTGG - Intergenic
1001971603 5:175959690-175959712 CCTCCTGTCTTCTCTGCTTCTGG - Exonic
1002097524 5:176840263-176840285 GCTCCAGTCTCCTCTCCCTCAGG - Intronic
1002245838 5:177884087-177884109 CCTCCTGTCTTCTCTGCTTCTGG + Intergenic
1002250840 5:177928182-177928204 TCTCCTCTCCCCTCTCCCTGTGG + Intergenic
1002455325 5:179342962-179342984 TAGCCTCTCTCTTGTCCTTCAGG + Intronic
1002725073 5:181289290-181289312 ACTCCTCCCTCCCCTCATTCAGG + Intergenic
1002968683 6:1992367-1992389 ACTCCTCCCTCCCCTTCTTCAGG + Intronic
1003299929 6:4870605-4870627 TCTCCCCTCTCCTCTCCTTAGGG + Intronic
1003423576 6:5980426-5980448 TTTTCTCTGTTCTCTCCTTCTGG + Intergenic
1003602154 6:7527264-7527286 TCTCCTTTCTCCTACCCTTGGGG + Intergenic
1003758989 6:9153487-9153509 CCTCCTCTCTTCTCTTATTCTGG - Intergenic
1004031546 6:11874843-11874865 TCATTTCTCTCCTCTCTTTCTGG + Intergenic
1004546488 6:16603302-16603324 ACTCCTCCCTCCTCTCCTTCTGG + Intronic
1004756091 6:18611947-18611969 TCTCATTTCTCCTCTGCTTTTGG + Intergenic
1005003736 6:21267868-21267890 TCCCCTCTCCCCTCAGCTTCTGG - Intergenic
1005166849 6:22933834-22933856 TCCTTTCTCTCCACTCCTTCTGG + Intergenic
1005401656 6:25440214-25440236 TCTCCTGTCTCATCTGCTTCAGG - Intronic
1005679897 6:28196335-28196357 GCCCCTCTCTCCTTTCCTTCTGG + Intergenic
1005797500 6:29381032-29381054 TTTTCTTTCTCCTCTTCTTCTGG - Intronic
1005825614 6:29630152-29630174 TCACCTCTCTCACCTTCTTCAGG - Intronic
1005985501 6:30871640-30871662 TCCTGTTTCTCCTCTCCTTCTGG + Intergenic
1006025604 6:31144936-31144958 CCTCCTCTGTGCTCTCCTGCTGG + Exonic
1006139097 6:31916664-31916686 GCTCCTGCCTCCTGTCCTTCAGG - Intronic
1006336040 6:33420885-33420907 TCTTCTCTCTTCCCTCCATCTGG - Intronic
1006397156 6:33795046-33795068 TCGAGTCTCTCCTCTCCTCCTGG + Intronic
1007042102 6:38732246-38732268 TCACATCTCTCCTCTTCATCAGG + Intronic
1007339437 6:41181165-41181187 TCTCCATCCTCCTCTCTTTCTGG + Intergenic
1007547762 6:42707455-42707477 TCTCCTCTGGTCTCTCCTGCTGG + Intronic
1007593712 6:43038726-43038748 CCTCTTCTCTCCACTCCTTGGGG - Intronic
1008247015 6:49188852-49188874 CCTTCTCTCTCCTTTCCTTTGGG - Intergenic
1008654495 6:53597713-53597735 TTTTCTTTCTCTTCTCCTTCTGG + Intronic
1008711033 6:54227401-54227423 TTTCTTCTCTCTTCTCTTTCTGG - Intronic
1008883121 6:56402201-56402223 CCTCCTCTCTCTTCTCCTTCCGG + Intergenic
1008955900 6:57215205-57215227 TCTTCTTTCTCCTCTCCTCCTGG - Intronic
1009806552 6:68607381-68607403 TCCCTTCGCTGCTCTCCTTCAGG - Intergenic
1010044714 6:71427790-71427812 TCTCTTCTATCCTCACATTCAGG - Intergenic
1010155187 6:72784315-72784337 TCTCTTCTCTTCTCTCTATCAGG - Intronic
1010578665 6:77566225-77566247 TCACCCCACTCCACTCCTTCTGG - Intergenic
1010818686 6:80388841-80388863 TCTCTTCACTGCTGTCCTTCAGG - Intergenic
1011074408 6:83422910-83422932 TTTTCTTTCTCCTCTCTTTCTGG - Intronic
1011131142 6:84052833-84052855 GCTCCTCTCTTCCCACCTTCAGG + Intronic
1011328075 6:86172924-86172946 TCTCCTCTTCCCCCTTCTTCAGG - Intergenic
1011330530 6:86200621-86200643 TTCACTCTCTCCTTTCCTTCTGG - Intergenic
1011546628 6:88488453-88488475 TCTGTTCTCCCCACTCCTTCAGG + Intergenic
1011616698 6:89203914-89203936 CCTCCTCTCTCATCTCCTGTCGG - Intronic
1011996708 6:93598812-93598834 TTACCTCTTTCTTCTCCTTCTGG + Intergenic
1012148249 6:95713470-95713492 TCTCCCCTCCCCTCAGCTTCTGG - Intergenic
1013079651 6:106801194-106801216 TCCCTGCTCTCCTCTCCTTGAGG - Intergenic
1013419604 6:109954828-109954850 CTTTCTCTCCCCTCTCCTTCTGG - Intergenic
1013782555 6:113745247-113745269 TCTCCTCTCTGCTCTACTCCAGG - Intergenic
1014292269 6:119572264-119572286 TTCACTCTCTCATCTCCTTCTGG - Intergenic
1014750624 6:125251992-125252014 GCTCTTCTCTCCTGTGCTTCCGG + Intronic
1014814267 6:125918217-125918239 TCTACTGTCTCCTCACCTGCTGG + Intronic
1014856873 6:126412644-126412666 TGCTTTCTCTCCTCTCCTTCTGG + Intergenic
1016056485 6:139583060-139583082 TATCCTCTTTTCCCTCCTTCAGG - Intergenic
1016206193 6:141471545-141471567 TTTCCTCTGTCCTCTCTTTGTGG - Intergenic
1016424414 6:143918646-143918668 TTTTCTCTCTCTGCTCCTTCAGG + Intronic
1016594365 6:145782779-145782801 TTTACTCTCTCCTGGCCTTCAGG - Intergenic
1016756036 6:147688014-147688036 TTTTCTTTCTCCTCTCCATCTGG + Intronic
1017008716 6:150047269-150047291 CCTCCCTTCTCCTCTCCTGCAGG - Intergenic
1017285181 6:152666805-152666827 TTTTCTCTCTCTTCTCCTTCTGG + Intergenic
1017363732 6:153607168-153607190 TTTTCTCTCTGCTCTCCTCCTGG - Intergenic
1017364916 6:153624434-153624456 TTTCATCTTTCCTCTCATTCTGG + Intergenic
1017640360 6:156487725-156487747 TCTCCTATCTACTCTCCTAAAGG - Intergenic
1017782307 6:157725394-157725416 TCCTCTCTCTCCTCCACTTCAGG + Intronic
1017932420 6:158969607-158969629 TCTCTTCTCTCCTCTCCTTCTGG + Intergenic
1017967628 6:159280210-159280232 TCTCCACTCTGCTCTGCTGCGGG - Intergenic
1018457966 6:163969749-163969771 TCTCATCTCTCCTGTGCCTCGGG + Intergenic
1019041442 6:169109258-169109280 TCTCCTGCCTCCCCTACTTCAGG + Intergenic
1019142901 6:169959504-169959526 CCTCCTCCCTCCTCTCCCCCTGG + Intergenic
1019166319 6:170099978-170100000 GCTTCTCTCTCCTCACGTTCTGG - Intergenic
1019295792 7:273542-273564 TCCTCACTCTCCTCTCCTTCTGG + Intergenic
1019495429 7:1337293-1337315 TTTTCTCTCCCCTCTCCTTCAGG + Intergenic
1019609349 7:1929142-1929164 TCCCCTCCCTCCTCCCCTCCCGG + Intronic
1019630032 7:2044037-2044059 TCTCCCCTCCTCTCTCCATCAGG - Intronic
1019764190 7:2837386-2837408 CCCTCTCTCTCATCTCCTTCTGG - Intronic
1019915187 7:4128567-4128589 TCTCCTCTATGCTCTCCTCCAGG - Intronic
1019915322 7:4128999-4129021 TGTCCTCTGTGCTCTCCTCCAGG - Intronic
1019924399 7:4182613-4182635 CCTTCTCCCTCCTCTCCCTCAGG - Intronic
1020064803 7:5179555-5179577 TCTTCTCAATCCTATCCTTCTGG + Intergenic
1020255890 7:6503085-6503107 TCTCCTCTGTCTTCTCCTGGAGG + Exonic
1020850421 7:13346129-13346151 TCTGCTCTCTCTTCTCCCTCAGG + Intergenic
1020898131 7:13968723-13968745 TATCCTTTCTCTTTTCCTTCTGG + Intronic
1021731401 7:23598529-23598551 TCACCTCTCCCCTCCCCCTCAGG + Intronic
1021795714 7:24251919-24251941 TTTCCTCTTTCTTCTCCTTTTGG - Intergenic
1021832224 7:24626375-24626397 TTCCCTCTCTCCTTTCTTTCTGG - Intronic
1022080288 7:27013128-27013150 ACGCCTGTCTCCTCTCCTTCAGG - Intergenic
1022270772 7:28805501-28805523 TCTCCTCTGTCATCTGCCTCTGG + Intronic
1022420457 7:30216153-30216175 TCTTTTCTTTCCTCTCCTTCTGG - Intergenic
1022604892 7:31802998-31803020 CCTCCTCTCTCCTCTACCTGGGG + Intronic
1022790086 7:33679593-33679615 TCTTCTCTATTCTCTCTTTCTGG + Intergenic
1022864046 7:34398772-34398794 TCTCCTAGCTCCTCCTCTTCGGG - Intergenic
1022873904 7:34508010-34508032 TCTCTTTTCTTCTCTCCCTCAGG - Intergenic
1023062624 7:36343323-36343345 CCTCTCCTCTCCTCTCCTACAGG - Intronic
1023241824 7:38156783-38156805 TTTTCTCTCTCTTCTCCCTCTGG - Intergenic
1023647451 7:42332697-42332719 TTTCCTATATCCTCTCCTTTTGG - Intergenic
1023884632 7:44344652-44344674 TCACCTTTCTTTTCTCCTTCTGG + Intergenic
1024004428 7:45215128-45215150 TGTCCTCTCTCCTCTGCTCACGG + Intergenic
1024204148 7:47140961-47140983 TCCCCTCTGTCCTCTCCTTGAGG + Intergenic
1024218906 7:47272515-47272537 TAGCCTCTCTCTTCTCCTTTGGG + Intergenic
1024252191 7:47514598-47514620 TCTCAACTCTCATCTCCTTTAGG + Intronic
1024414986 7:49096186-49096208 TCTTCCCTCTCCTCTCCTCAAGG - Intergenic
1024486779 7:49928480-49928502 TCTCTTCCCCACTCTCCTTCAGG + Intronic
1024499347 7:50086744-50086766 TTCTCTCTCTCCCCTCCTTCAGG - Intronic
1024546502 7:50525986-50526008 TTTCCTCTCTCCTCCCATTCTGG - Intronic
1024712447 7:52031719-52031741 TTTCCTCTCTCCTCTCCTTCTGG - Intergenic
1024813691 7:53243268-53243290 TGCACTCTCTCCTCTTCTTCAGG + Intergenic
1024903895 7:54354052-54354074 TCTCCTCTCACATCTCATTTAGG - Intergenic
1024955457 7:54914592-54914614 TGTCCTCTCTCCTCCTCTACAGG - Intergenic
1025159689 7:56645220-56645242 TCTCCACTCTTCTCACATTCTGG + Intergenic
1025225224 7:57153227-57153249 TCTTCTCTCTTTTCTGCTTCTGG + Intergenic
1025964853 7:66259500-66259522 TCTTCTTTCTCCTTTCCTTCAGG + Intronic
1025996965 7:66533966-66533988 TCCTCACTCTCCTCTCCTTGGGG + Intergenic
1026070157 7:67111624-67111646 TTCTCTCTCTCCTGTCCTTCTGG - Intronic
1026448458 7:70506198-70506220 TCTCTCCTCTCCTCTCAATCTGG - Intronic
1026626520 7:71997468-71997490 TTTTGTGTCTCCTCTCCTTCTGG - Intronic
1026706755 7:72700639-72700661 TTCTCTCTCTCCTGTCCTTCTGG + Intronic
1026730531 7:72907833-72907855 TGCACTCTTTCCTCTCCTTCTGG + Intronic
1026744275 7:72998917-72998939 TTTCCTCTCTCAGCTCCTTGGGG - Intergenic
1026799222 7:73388028-73388050 TCCTCCCTCTCCTCTCTTTCTGG + Intergenic
1026989862 7:74578639-74578661 TCCTCTCTCTCCCCTCCTTGGGG + Intronic
1027030381 7:74883590-74883612 TTTCCTCTCTCAGCTCCTTGGGG - Intergenic
1027099462 7:75366175-75366197 TTTCCTCTCTCAGCTCCTTGGGG + Intergenic
1027438252 7:78190030-78190052 TCTCATCTGTCTTCTTCTTCTGG - Intronic
1027485589 7:78757694-78757716 TCTTCTTCCTCCTCTCATTCTGG + Intronic
1027684138 7:81260560-81260582 TTTGTTCTCTCTTCTCCTTCGGG + Intergenic
1027877812 7:83793650-83793672 TCTCCTTTTACCTCTCTTTCTGG - Intergenic
1028625915 7:92876694-92876716 CCTTCTTTCTCTTCTCCTTCTGG - Intergenic
1028914213 7:96240967-96240989 CCTCCCCTCTCCTCTCCTTTCGG - Intronic
1029097244 7:98097461-98097483 TTCTCTCTATCCTCTCCTTCTGG + Intergenic
1029336124 7:99901036-99901058 CCTCCCCACTCCTCTCTTTCAGG + Intronic
1029452271 7:100647675-100647697 CATTCTCTCTCCTCTCCATCAGG - Intronic
1029569491 7:101360306-101360328 TCCCCTCTCCCCTCTCCTCTCGG - Intergenic
1030086484 7:105819954-105819976 TCTCCTTCCTCTTCTCCTTCAGG - Intronic
1030238260 7:107291151-107291173 TTACATCTCTCCTCTCCTTGTGG + Intronic
1030259288 7:107545179-107545201 TCTTCTCTCTCTGCTCCTTCTGG - Intronic
1030438857 7:109559850-109559872 TCTCCTCTCTCCTATTCTTGAGG + Intergenic
1030684568 7:112471453-112471475 TCTCCTTTCTCCTCTCCCTGTGG + Intronic
1031090764 7:117350951-117350973 TTTTCTTTCTCCTCACCTTCTGG - Intergenic
1031328992 7:120439656-120439678 TCTCCTCTCCCATATCCTTCAGG + Intronic
1031407498 7:121404297-121404319 TCTCTTCTCTCCTAGCCTTGAGG - Intergenic
1031465673 7:122107745-122107767 GCTCCTCTCCCTTCTCCCTCAGG - Intronic
1031681486 7:124680635-124680657 CCCACTCTATCCTCTCCTTCCGG + Intergenic
1031682952 7:124696890-124696912 TCTCCTCTCACCAGCCCTTCTGG - Intergenic
1031751929 7:125585904-125585926 TCTGCTCTTACTTCTCCTTCAGG + Intergenic
1031923504 7:127618167-127618189 CCTCCTCTCTCCTCTGCTCATGG - Intergenic
1032054744 7:128675282-128675304 TCCTCACTTTCCTCTCCTTCTGG + Intronic
1032114977 7:129109324-129109346 CTTTCTCTCTCCTCTCCTTCTGG + Intergenic
1032260793 7:130335109-130335131 TCTGTTCTCTCTTCTCCTTCTGG - Intergenic
1032281316 7:130504555-130504577 CCCCCTCTCTCATCTCCTCCTGG + Intronic
1032593202 7:133212655-133212677 TGTCCTCTCTTCTTTCCTTGAGG - Intergenic
1032689931 7:134275438-134275460 TCACCTCTCATCTCTCCTGCTGG - Intergenic
1033264629 7:139874119-139874141 TCTCCTCTCATCTCTCTCTCTGG + Intronic
1033317541 7:140310146-140310168 TTTGTCCTCTCCTCTCCTTCCGG + Intronic
1033319082 7:140323351-140323373 TCTCCCCACTCCCCTGCTTCTGG - Intronic
1033403736 7:141051874-141051896 TCCTTTCTCTCCTCTCCTTCTGG - Intergenic
1033851441 7:145501047-145501069 TTCTTTCTCTCCTCTCCTTCTGG + Intergenic
1034008636 7:147503906-147503928 TCTCCTCTCCCTTCTCCTCAGGG - Intronic
1034198694 7:149267128-149267150 GCTCCTCTCCCCTCTCTATCCGG - Exonic
1034235662 7:149567129-149567151 TGTCTTCTCTTCACTCCTTCTGG + Intergenic
1034405961 7:150902591-150902613 TCTCCTGGAGCCTCTCCTTCAGG + Intergenic
1034470918 7:151253939-151253961 ACTCTCCTCTCCTCTCCCTCCGG + Intronic
1034713211 7:153215516-153215538 TTCTCTCTCTCTTCTCCTTCTGG + Intergenic
1034752974 7:153588062-153588084 GCTCCACTCTCCTGTCATTCAGG - Intergenic
1035005928 7:155660832-155660854 TCCTGTCTGTCCTCTCCTTCTGG + Intronic
1035230884 7:157464842-157464864 TCACCTCTGTCCCCTCCATCTGG - Intergenic
1035346880 7:158206179-158206201 TCTTCCCTCTCCTCTCCTCAAGG - Intronic
1035537745 8:405480-405502 TCCCCTCTTTCCCCTCCTACCGG + Intergenic
1035559902 8:596447-596469 TCTCCCTGCTCCTCACCTTCAGG - Intergenic
1035570571 8:669981-670003 CGTCCTCTCTCCTCTCCACCTGG + Intronic
1036000182 8:4593984-4594006 TCTTGTCTCTCCACACCTTCTGG + Intronic
1036115831 8:5960054-5960076 TTTCCTGTCTCCTCACCCTCTGG - Intergenic
1036159840 8:6377002-6377024 TCTTTTCTTTTCTCTCCTTCTGG - Intergenic
1036544892 8:9758354-9758376 TTTCATCTCTTCTATCCTTCAGG + Intronic
1036784848 8:11679480-11679502 GCTCCACTCTCCTCTCCTCCCGG - Intronic
1037948557 8:23004403-23004425 CCGCCTCCCTCCTCTCCCTCAGG + Exonic
1037976815 8:23219717-23219739 GCTCCCCTCTCCTCTTCATCAGG + Intronic
1038137836 8:24808392-24808414 TCTCTTCTCTCTTCTCCTTCTGG - Intergenic
1038152668 8:24956559-24956581 TCTCCCCTGTCCTCTCTCTCCGG - Exonic
1038221888 8:25616666-25616688 TTTTCTTTCTCTTCTCCTTCTGG - Intergenic
1039263733 8:35802165-35802187 TTCACTCTCTCATCTCCTTCAGG - Intergenic
1039729669 8:40260653-40260675 CCTTCTCTCTACTTTCCTTCAGG - Intergenic
1039956980 8:42215204-42215226 GCTCCTCTCTCCTCCCCGCCAGG + Intergenic
1040483787 8:47851596-47851618 TCTACTCTGTCCTTTCTTTCAGG + Intronic
1040639607 8:49317988-49318010 TGACCTCTCTCCTCTGCCTCAGG - Intergenic
1040669114 8:49665785-49665807 TCTCCTCTCTCCTCTTATAAAGG + Intergenic
1041146001 8:54876280-54876302 TCTCAACCCTCCTCTCCATCAGG - Intergenic
1041155714 8:54984508-54984530 TTTTCTTTGTCCTCTCCTTCTGG + Intergenic
1041163663 8:55070535-55070557 TCTCCTCTCTTCCCTCCAACAGG - Intergenic
1041594635 8:59633788-59633810 TCTAATTTCTCCTCCCCTTCAGG + Intergenic
1041602232 8:59732853-59732875 TCCTTTCTCTCTTCTCCTTCTGG - Intergenic
1041639862 8:60185362-60185384 TTTTCTCTCTCCTTTTCTTCTGG - Intergenic
1042034197 8:64512988-64513010 TTCTATCTCTCCTCTCCTTCTGG + Intergenic
1042062505 8:64836281-64836303 TCTGGTTTCTCCTCTCTTTCAGG + Intergenic
1042133846 8:65616143-65616165 TCTCCCCTCTCCCCTCTTCCCGG + Intronic
1042731534 8:71940245-71940267 TTATCTCTCTCTTCTCCTTCTGG + Intronic
1043117007 8:76269450-76269472 TCCTCTTTCTCTTCTCCTTCTGG - Intergenic
1043719093 8:83522718-83522740 TCCTATCTCTCCTCTCTTTCTGG - Intergenic
1043821541 8:84872042-84872064 TCTTCTGTCTCTTTTCCTTCTGG - Intronic
1043984808 8:86681508-86681530 TTTCCTCTGTTCTCTCCTTTGGG - Intronic
1044023181 8:87132846-87132868 TTTCCTCTCTCCTCTCATTTTGG + Intronic
1044069929 8:87746256-87746278 TATATTCTCTCTTCTCCTTCTGG - Intergenic
1044129337 8:88501277-88501299 TGTCCTCTTTCCTCTCTTCCTGG - Intergenic
1044175897 8:89121918-89121940 TGTCCTCTCTACTCTCCCTGTGG - Intergenic
1044374488 8:91453448-91453470 TCTCATCTCTTCCCTCCTTCAGG + Intergenic
1044393306 8:91678895-91678917 TTTCCTATCCCCTTTCCTTCAGG - Intergenic
1044886866 8:96788724-96788746 TTTTCTTTTTCCTCTCCTTCTGG + Intronic
1044898209 8:96915695-96915717 CCTCCTCTGTCCTCTATTTCAGG + Intronic
1044985945 8:97756458-97756480 CCTGCTCTCTCCTCTCTCTCTGG + Intergenic
1045285405 8:100786464-100786486 GTCCCTTTCTCCTCTCCTTCTGG - Intergenic
1045651089 8:104342261-104342283 TCTCTTCTCTCCTCTCTGGCTGG - Intronic
1045715226 8:105035937-105035959 TCACCTTTTTCCCCTCCTTCTGG - Intronic
1046581382 8:116097021-116097043 TCTATGCTCTCTTCTCCTTCTGG + Intergenic
1046691665 8:117292616-117292638 GCTCTTGGCTCCTCTCCTTCTGG - Intergenic
1046999301 8:120557586-120557608 TCTCCTCTTTGATCTCTTTCTGG + Intronic
1048206933 8:132422941-132422963 TCTCCTTCCTGCCCTCCTTCAGG - Intronic
1048253089 8:132883413-132883435 TTTCCTTACTCCTCTCCTTCAGG - Intronic
1048622546 8:136150484-136150506 TTTTCTCTCTTCTCTTCTTCAGG + Intergenic
1049005034 8:139849441-139849463 TGCTCCCTCTCCTCTCCTTCTGG + Intronic
1049029743 8:140025256-140025278 TCTGCTGTGTCCTCTGCTTCCGG - Intronic
1049046672 8:140157417-140157439 TCTCCTCCCTCCCCTCCACCTGG - Intronic
1049269492 8:141686738-141686760 TCCCCTGTCCCTTCTCCTTCCGG + Intergenic
1049393358 8:142383178-142383200 TCTCCTGTCTCCCCTCCCTTAGG - Intronic
1049394514 8:142393598-142393620 TCTGCTCTCTCAGCACCTTCGGG - Intronic
1049430619 8:142562163-142562185 TCCACTGTCTCCTCTTCTTCTGG + Intergenic
1049741369 8:144242665-144242687 TCTCCTCTCGGCTCTCCTCTGGG + Intronic
1050004835 9:1119141-1119163 TCCCCTCTCTCAGCTCCATCAGG - Intergenic
1050023872 9:1312886-1312908 TCTCTGTTCTCTTCTCCTTCTGG - Intergenic
1050089495 9:2002985-2003007 TCTCTCCTGTCCTCTCCTACGGG + Intergenic
1050090744 9:2015428-2015450 TCTCCTCTTTCCCCTCCCTTCGG + Intronic
1050098263 9:2090721-2090743 TCTTGTCTTTGCTCTCCTTCCGG + Intronic
1051073400 9:13201517-13201539 TTTTCTCTCTGGTCTCCTTCAGG + Intronic
1051141925 9:13987525-13987547 TCCTCTTTCTCCTCTTCTTCGGG - Intergenic
1051227171 9:14911422-14911444 TTTCCTCTCTCTTTTCCTTATGG - Intergenic
1051348752 9:16178609-16178631 ACTATTCCCTCCTCTCCTTCTGG + Intergenic
1051636756 9:19187738-19187760 GCCCCTCTCTGCTGTCCTTCAGG + Intergenic
1051653048 9:19349300-19349322 TATCCTCCCACCTCACCTTCTGG - Intronic
1052472139 9:28912959-28912981 TCACATCTCTCATTTCCTTCTGG + Intergenic
1052856258 9:33408374-33408396 CCTTCTCTCTCCTCCCGTTCAGG - Intergenic
1053101696 9:35376886-35376908 TCTCCTTGCTCCCCTCCTGCTGG + Intronic
1053513727 9:38711452-38711474 TCTCCTCCCACCCCACCTTCAGG + Intergenic
1053584244 9:39439534-39439556 TTTGCTCTCTCTTGTCCTTCTGG - Intergenic
1053630736 9:39935392-39935414 CCTCCTCTGTCCTCTCTTTGTGG - Intergenic
1053775030 9:41528113-41528135 CCTCCTCTGTCCTCTCTTTGTGG + Intergenic
1054105824 9:60998280-60998302 TTTGCTCTCTCTTGTCCTTCTGG - Intergenic
1054213151 9:62315306-62315328 CCTCCTCTGTCCTCTCTTTGTGG + Intergenic
1054751686 9:68913783-68913805 TCTCCTCTGTACTCTTCTTTTGG - Intronic
1055002968 9:71474136-71474158 CCTTCTTTCTCCTCTCTTTCTGG + Intergenic
1055485287 9:76750466-76750488 TCTCCTCTCCTCTGTACTTCTGG - Intronic
1055542478 9:77326350-77326372 TGCCCTCTCTTCTCTCCTTTAGG + Intronic
1055653299 9:78429658-78429680 TCTTTTCTCACTTCTCCTTCTGG + Intergenic
1056460000 9:86800285-86800307 TCCCCTCTCTGCTCACCCTCTGG - Intergenic
1056703363 9:88930829-88930851 TTCTCACTCTCCTCTCCTTCCGG + Intergenic
1056785883 9:89592209-89592231 TCTGCTCTCTGTTCTCATTCTGG + Intergenic
1056846118 9:90039675-90039697 CCTCCTCACTGCTCTCCTGCTGG + Intergenic
1056978206 9:91281110-91281132 TACACTTTCTCCTCTCCTTCTGG + Intronic
1057136246 9:92690345-92690367 TTTTCTCTTTCTTCTCCTTCTGG + Intergenic
1057878655 9:98776749-98776771 TCTCCCCTCCTCTCTCCTGCTGG + Intronic
1058090640 9:100801987-100802009 TTTTCTCTCTCCTAGCCTTCTGG + Intergenic
1058257320 9:102783769-102783791 TCTTCTCTTTCCTCTCTCTCTGG - Intergenic
1058538189 9:105984720-105984742 TCTCCTGTCTCCCATCCATCTGG + Intergenic
1058957830 9:109965568-109965590 TCTCCTTTCTTCTCTCCCCCAGG - Intronic
1059014352 9:110498335-110498357 TCTCCTCTCCTCTCTCCTTCTGG + Intronic
1059107453 9:111524074-111524096 TCTCCTAACTCCACCCCTTCAGG + Intergenic
1059244131 9:112835059-112835081 TCTGCTCTATCCTCTGCATCAGG + Intronic
1059372271 9:113851670-113851692 TTTCTTCTCTCCTCTCATTCTGG + Intergenic
1059488890 9:114650589-114650611 TCTTCTCTCTCATCTTGTTCAGG + Intergenic
1059571570 9:115443107-115443129 GCTCCTCTCTCCACTCATTATGG - Intergenic
1059796704 9:117705368-117705390 TCTCCTATATCCTCAACTTCAGG - Intronic
1060269960 9:122133278-122133300 ACTCCTCTCTCTCCTCTTTCTGG + Intergenic
1060372814 9:123090525-123090547 TCACTTCCCTCCTTTCCTTCAGG + Intronic
1060444771 9:123677913-123677935 TCCCCTCACTCCTCTCACTCCGG + Intronic
1060613117 9:124986573-124986595 GCTTCTCTCTCCTCACCTTATGG - Intronic
1060859042 9:126938885-126938907 CCTCCTCCCTCCTCTACTCCTGG - Intronic
1061062525 9:128257835-128257857 GTTCCTCTACCCTCTCCTTCAGG + Exonic
1061127485 9:128686053-128686075 TTGCCTCTCTCCTCTCCTCCTGG - Intronic
1061178437 9:129010718-129010740 CCTCCTCTCCCCTCCCCTGCTGG - Intronic
1061246558 9:129403788-129403810 TCCCCTCTCCTCTCTCCCTCAGG + Intergenic
1061636221 9:131910811-131910833 TCTGCTCTGTCCTCCCCTCCTGG + Intronic
1061677479 9:132226597-132226619 TCTCCTCTCTGCTCTGATGCTGG - Intronic
1061740159 9:132697223-132697245 TCTTCTTTCTCCTTTCCTTCTGG - Intergenic
1061899711 9:133666596-133666618 TCTCTTCCCTCCTCCTCTTCTGG + Intronic
1062194738 9:135266733-135266755 TCTGCTCCCTCCTGTCCTCCTGG + Intergenic
1062271890 9:135713654-135713676 TCCCCCCTCTGCTCTCCTGCTGG + Intronic
1062377767 9:136271106-136271128 CTTTCTCTCACCTCTCCTTCAGG - Intergenic
1185707186 X:2276648-2276670 TCTCCCTTCTCCTCCCGTTCAGG - Intronic
1185909049 X:3965581-3965603 GTTCGTCTCTCATCTCCTTCTGG - Intergenic
1186207474 X:7215715-7215737 TCTCCTCTGTTCCCTCCTGCAGG + Intergenic
1186296154 X:8150856-8150878 TCTCCTATCTCCATTTCTTCAGG - Intergenic
1186417139 X:9393593-9393615 TTCCCTCACTCCTCTCCTTAAGG + Intergenic
1186536365 X:10353394-10353416 TCTCCTCTGTTCTCTCCTTATGG - Intergenic
1187237943 X:17485727-17485749 TTGCATTTCTCCTCTCCTTCAGG - Intronic
1187459256 X:19471199-19471221 TCCTTTCTCTCCTCTTCTTCTGG - Intronic
1187646728 X:21355429-21355451 TTATCTCTCTCCTCTCTTTCTGG + Intergenic
1188847167 X:35087396-35087418 TCTCCTTTCTCATCTCCATATGG - Intergenic
1188921646 X:35985386-35985408 TCTCCCCTCTCCTCCCCTGCTGG - Intronic
1189150001 X:38696919-38696941 TCTTCTCTGTGCTCTCCTCCTGG + Intergenic
1189246295 X:39566088-39566110 TTTCCTCTTTCCTTTCCTCCTGG + Intergenic
1189248894 X:39584795-39584817 GCTCCTCTCTCCTCACTCTCTGG - Intergenic
1189554903 X:42132262-42132284 TTTGCTCTCTCTTCTCCTTTTGG + Intergenic
1189621816 X:42848631-42848653 TTTTCTCTCTCCTCTCCTTCTGG - Intergenic
1189703234 X:43733430-43733452 TTTCCCCTCTCTTCTCATTCCGG + Intronic
1190120085 X:47651895-47651917 TCTCTTCTGTCCTCTTTTTCAGG - Exonic
1190156303 X:47995571-47995593 TCCTCTTTCTCCTCTCCTTCTGG - Intronic
1191662991 X:63669697-63669719 TTTGCTCCTTCCTCTCCTTCAGG + Intronic
1191699881 X:64030324-64030346 TCCCCTCTCCCTTCTTCTTCTGG + Intergenic
1192841031 X:74856468-74856490 TTTTCTCTCTCCTCCGCTTCTGG - Intronic
1192965349 X:76171362-76171384 TCTCCACTTTCCTCTCCTTTTGG - Intergenic
1193451045 X:81667408-81667430 TCTCCTTTCTCATGTTCTTCAGG + Intergenic
1193922799 X:87449304-87449326 CCTCCTCACTTCTCTCTTTCCGG + Intergenic
1194342711 X:92724241-92724263 TCCCATTTCTCTTCTCCTTCTGG - Intergenic
1194369489 X:93054712-93054734 TCTCTCCTTTCTTCTCCTTCTGG + Intergenic
1195146514 X:102022925-102022947 TTCTCTCTCTCTTCTCCTTCTGG - Intergenic
1196076835 X:111586976-111586998 GCTCGCCTCTTCTCTCCTTCAGG + Intergenic
1196659149 X:118251963-118251985 TTTCTTCTCTTGTCTCCTTCAGG + Intergenic
1196750634 X:119114281-119114303 TCTCTCCTCTCCTCTCCTGTTGG - Intronic
1196895965 X:120335993-120336015 TTCTCTCTCTCCTCTCTTTCTGG + Intergenic
1197009929 X:121547988-121548010 TTTCCTTTCTCTTCTCCTTCAGG - Intergenic
1197084785 X:122459021-122459043 TCTCCTCCCTCCTCTCTTAGAGG - Intergenic
1197108170 X:122740790-122740812 TCCACTATCTCTTCTCCTTCTGG - Intergenic
1197211679 X:123833294-123833316 TCTCCTTTGTCCTCAGCTTCTGG - Intergenic
1197609919 X:128626624-128626646 TTCACTCTCTCATCTCCTTCAGG - Intergenic
1197646145 X:129019080-129019102 CATCCTCTCTCCTCTGCCTCTGG + Intergenic
1197706401 X:129637583-129637605 TCTCCTCTTTCCTGTTCTGCAGG - Intergenic
1198194062 X:134342125-134342147 TGTTCTCTTTCCTCTCCTTCTGG - Intergenic
1198497327 X:137205520-137205542 TCTCCTCTCCTCTCCCCTTTTGG + Intergenic
1198513723 X:137382031-137382053 TTTTCTCTTTCCTCTCCTTCTGG - Intergenic
1198771416 X:140134796-140134818 TATCCTCTCTCCTCAGCTCCTGG + Intergenic
1198818126 X:140614740-140614762 TCTTCTCTCTTCTCTCCTCAAGG + Intergenic
1199174353 X:144767528-144767550 TTTTCACTCTCTTCTCCTTCTGG + Intergenic
1199241885 X:145556374-145556396 TTTGCTTTCTCCTCTCCCTCAGG - Intergenic
1199683802 X:150246401-150246423 TTTTCTCTCTCCTCTCCTTCTGG - Intergenic
1199807871 X:151318846-151318868 TCCCCTCACTACTCTCCTTATGG + Intergenic
1200009731 X:153111995-153112017 ACTCCTCTCTGCTCTCCCACTGG - Intergenic
1200029869 X:153287927-153287949 ACTCCTCTCTGCTCTCCCACTGG + Intergenic
1200651072 Y:5840906-5840928 TCCCATTTCTCTTCTCCTTCTGG - Intergenic
1200677681 Y:6170922-6170944 TCTCTTCTTTCTTCTCCTTCTGG + Intergenic
1201425029 Y:13840625-13840647 TTTTCTCTCTTCTCTCCTTCTGG + Intergenic
1201579319 Y:15494379-15494401 TCTCCTCTGTTCCCTCCTGCAGG + Intergenic
1201918883 Y:19212780-19212802 CCTCCTCACTCCTCTCCTTCAGG - Intergenic