ID: 970625620

View in Genome Browser
Species Human (GRCh38)
Location 4:17875727-17875749
Sequence ACTTGGGGACCTATTTTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970625616_970625620 4 Left 970625616 4:17875700-17875722 CCAATTGGTCGCTTAATCTGTTT 0: 1
1: 0
2: 0
3: 10
4: 140
Right 970625620 4:17875727-17875749 ACTTGGGGACCTATTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970625620 Original CRISPR ACTTGGGGACCTATTTTTTT TGG Intronic
No off target data available for this crispr