ID: 970629412

View in Genome Browser
Species Human (GRCh38)
Location 4:17924425-17924447
Sequence GAGCCCAATTTGCCAGAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 2, 1: 0, 2: 1, 3: 10, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970629407_970629412 15 Left 970629407 4:17924387-17924409 CCAATCACCAAGGCTGACCTGGC 0: 2
1: 186
2: 201
3: 188
4: 309
Right 970629412 4:17924425-17924447 GAGCCCAATTTGCCAGAAGCCGG 0: 2
1: 0
2: 1
3: 10
4: 101
970629410_970629412 -2 Left 970629410 4:17924404-17924426 CCTGGCTACGGCCACTGCTGAGA 0: 2
1: 31
2: 194
3: 214
4: 258
Right 970629412 4:17924425-17924447 GAGCCCAATTTGCCAGAAGCCGG 0: 2
1: 0
2: 1
3: 10
4: 101
970629409_970629412 8 Left 970629409 4:17924394-17924416 CCAAGGCTGACCTGGCTACGGCC 0: 33
1: 185
2: 176
3: 178
4: 250
Right 970629412 4:17924425-17924447 GAGCCCAATTTGCCAGAAGCCGG 0: 2
1: 0
2: 1
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970629412 Original CRISPR GAGCCCAATTTGCCAGAAGC CGG Intronic
900196753 1:1380562-1380584 GAGGCCATTTTGCCATCAGCAGG - Intergenic
902090690 1:13900625-13900647 GAGACCTATTTGTCAGAGGCAGG + Intergenic
903411809 1:23150808-23150830 AAACCCACTTTCCCAGAAGCTGG + Intronic
905003701 1:34693808-34693830 GAGCCCAAGGAGCCAGAAGTTGG + Intergenic
908052446 1:60247661-60247683 GTGCCCAATTTGCCAGCAGCAGG + Intergenic
910141663 1:84032975-84032997 GTGCCCAATATGCCAGCATCAGG + Intergenic
910155608 1:84215064-84215086 GAGACCAATATGCCACAAGAAGG - Intronic
910305423 1:85757279-85757301 GAGGACAAATTGCCAGAAGTAGG - Intronic
914349030 1:146823699-146823721 GAGCCCAATATTTCAGAAGGAGG + Intergenic
917792744 1:178509803-178509825 GAGCCCTGTTTGGCAGGAGCAGG + Intergenic
917843753 1:179003367-179003389 GAGCTGAATTTTCTAGAAGCTGG + Intergenic
919481329 1:198093431-198093453 CAGACCAAATTGCCAGAAGTGGG + Intergenic
919771656 1:201164628-201164650 GATCCCATTGTGCCTGAAGCTGG - Intronic
922870559 1:228898872-228898894 CCGCCCCATTTGGCAGAAGCAGG + Intergenic
923042211 1:230327477-230327499 CAGCTCAATTTCCCACAAGCTGG - Intronic
1064133055 10:12727108-12727130 GGGCCCAAATAGCCAGGAGCTGG + Intronic
1067258172 10:44663308-44663330 CAGTCCATATTGCCAGAAGCAGG + Intergenic
1070916344 10:80157611-80157633 GAGCCCAGTTGGCCTGCAGCAGG + Intronic
1078078239 11:8180910-8180932 GAGCCCAATGTGGCTGGAGCTGG - Intergenic
1079556966 11:21771225-21771247 GGGCACAATTTCCCAGCAGCTGG + Intergenic
1082797147 11:57386520-57386542 GAGCCCTATTTTACAGAACCAGG - Intergenic
1088583730 11:111339910-111339932 GAGCTCAAGTTGCCAGTATCAGG + Intergenic
1088787351 11:113194137-113194159 GAAACCAACTAGCCAGAAGCAGG - Intronic
1089811513 11:121135861-121135883 GGTCACAATTTGCCAGAGGCAGG - Intronic
1101540438 12:105659927-105659949 GAGACCAGTCTGCCAGAGGCTGG - Intergenic
1105428748 13:20318069-20318091 GTGCCCCATCTGCCAGCAGCAGG + Intergenic
1108294502 13:48999877-48999899 GAACCAAATTTGCCAGCATCTGG + Intronic
1108733285 13:53257001-53257023 CAGCCTTCTTTGCCAGAAGCTGG - Intergenic
1113562235 13:111291113-111291135 GAGGTCAATTTGATAGAAGCAGG + Intronic
1118807098 14:69247477-69247499 GACCCCAATTTGGTAAAAGCAGG - Intergenic
1129440354 15:75577366-75577388 GAGCCCATTCTGCCAGAATTGGG - Intronic
1131862998 15:96674709-96674731 GACCCAGATTTGGCAGAAGCGGG + Intergenic
1132338201 15:101062251-101062273 GAGTCCACTTTGCCAGTACCAGG + Intronic
1137519452 16:49179719-49179741 GTGCCCAATTTGCCATCTGCAGG - Intergenic
1139985003 16:70891856-70891878 GAGCCCAATATTTCAGAAGGAGG - Exonic
1146952426 17:36916218-36916240 CACCCCAACTGGCCAGAAGCAGG + Intergenic
1148749418 17:49935902-49935924 GAGCACCAAGTGCCAGAAGCAGG - Intergenic
1149291937 17:55225867-55225889 GAGCTCTATTTTCCAGAATCAGG + Intergenic
1151848490 17:76674788-76674810 GATCCCAATTGGCCAGAATATGG - Exonic
1158814452 18:61077719-61077741 GAGCTCAATTTGCAACCAGCAGG - Intergenic
1163565298 19:18047536-18047558 AAGCCCAAGTTCTCAGAAGCTGG - Intergenic
1168057492 19:53871321-53871343 GAGCTGAGTTTCCCAGAAGCTGG + Intronic
925914472 2:8595124-8595146 TATCCCAATTTGCTACAAGCGGG + Intergenic
931487395 2:62706337-62706359 GAGCCCAAGTGGCCTGGAGCCGG + Intronic
931936888 2:67208473-67208495 GAAACCAATTTCCCAGAACCAGG + Intergenic
932888846 2:75572621-75572643 GAGCAGAAGTAGCCAGAAGCAGG - Intergenic
933238848 2:79896916-79896938 GAGACCACTTTGGCAGGAGCCGG + Intronic
933595293 2:84277436-84277458 TAGCCCAACTTGACAGAAGCTGG - Intergenic
934613015 2:95754718-95754740 GAGCTGAGTTTGGCAGAAGCAGG - Intergenic
934734793 2:96684580-96684602 GAGAAGAATGTGCCAGAAGCAGG + Intergenic
936354367 2:111737610-111737632 GAGCCCAATGTGCCATCAACCGG + Intergenic
938407158 2:131039048-131039070 GGGCCCAACTTGGGAGAAGCTGG - Intronic
939007973 2:136811013-136811035 GAACCCAACTTGACAGAAGTTGG + Intronic
940680527 2:156779654-156779676 GAGTCTATTTTGCCAGAGGCAGG + Intergenic
1169051154 20:2578973-2578995 GAGCCCAGGCTGCCAGAGGCAGG - Intronic
1170048318 20:12111598-12111620 GGGGCCAATTTGGCTGAAGCTGG + Intergenic
1170528264 20:17262780-17262802 GAGACCAAGTAGCCAGAAGGAGG + Intronic
1181527204 22:23496725-23496747 GAGCCCAGTTTGACAGGAGATGG + Intergenic
950747680 3:15103341-15103363 GTGCCCCATTTGCCAAATGCAGG - Intergenic
951329126 3:21344135-21344157 TAGCCAAATTTACCAGATGCAGG - Intergenic
957273948 3:78066106-78066128 GAGCCAAATTTCCCACAAGAAGG + Intergenic
964640714 3:158907240-158907262 GAGGCAAAATTTCCAGAAGCTGG - Intergenic
967732925 3:192922803-192922825 GTGCCCGATTTGCCCCAAGCAGG - Intergenic
969416928 4:7067125-7067147 GGGCCAAATTGGCCAAAAGCTGG - Intronic
970629412 4:17924425-17924447 GAGCCCAATTTGCCAGAAGCCGG + Intronic
970644954 4:18109047-18109069 GAGCCCAATTTGCCAGAAGCAGG - Intergenic
974478929 4:62419969-62419991 GTGCCCAATTTTCCAGTAGTAGG - Intergenic
977204838 4:94156557-94156579 GTGCCCAATCTGCAAGCAGCAGG + Intergenic
979226418 4:118290969-118290991 CAGACCAATTTGCCAGAAAAAGG + Intronic
979898288 4:126188144-126188166 GTGCCCAGTTTGCCAGCAGCAGG - Intergenic
984177730 4:176439873-176439895 GAGGTGAATTTGCCAGAGGCAGG + Intergenic
989455529 5:41639181-41639203 CAACCCAATTTCCCAAAAGCTGG + Intergenic
989826466 5:45862821-45862843 GAGACCAATTTGCCACTAGATGG + Intergenic
992102660 5:73422249-73422271 GAGCCAAATTTGTCAGCACCTGG - Intergenic
992548487 5:77839197-77839219 GTGACCAATTTGCCAGAGGTGGG + Intronic
994600236 5:101893468-101893490 TAGCCCAACCTGCCAGAAGAAGG + Intergenic
997396165 5:133561567-133561589 GAGGCCAATGTGCCAGGAGAAGG + Intronic
999736539 5:154517435-154517457 CAGCCCAAATTGCCAGACACAGG - Intergenic
1000029543 5:157390093-157390115 GAGGCCAACTGGCCAGAAGCAGG - Intronic
1001437688 5:171713237-171713259 GAGCCCAGTGTGGCAGAAACTGG + Intergenic
1001492639 5:172166227-172166249 GAGGCCAAGATGGCAGAAGCAGG + Intronic
1002542943 5:179918137-179918159 GACCCCAATTTTCCAGAAAAGGG + Intronic
1005656719 6:27946244-27946266 GAGACCAATTTGTCTGAAACAGG - Intergenic
1013928290 6:115499695-115499717 GGGAGCAATTTGCCAGAATCTGG - Intergenic
1015745981 6:136510241-136510263 GAGCCCAATTTGCTGCTAGCCGG - Intronic
1015819713 6:137247802-137247824 GATTCCATTTTGTCAGAAGCTGG + Intergenic
1015957864 6:138616804-138616826 GAGCCTAATCTGCCAGAACCAGG + Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1028642834 7:93062489-93062511 GAGCTTATTTTCCCAGAAGCTGG - Intergenic
1031618740 7:123910428-123910450 GAGCCCAATTTGCCAAAAATAGG + Intergenic
1032085473 7:128881290-128881312 GAGCCCAAAGGGCCAGAGGCTGG + Intronic
1033291091 7:140083240-140083262 GAGTCCACTTTTCCAGGAGCTGG - Intergenic
1034571043 7:151956621-151956643 GAGCCCCATGTGCTAGAAGTGGG + Intronic
1035895799 8:3399255-3399277 GAGCACACTTTACCAGAAACAGG - Intronic
1036674044 8:10814514-10814536 CAATCCAATTTGCCAGAAACTGG - Intronic
1037141968 8:15531128-15531150 GAGCTCAAGTTGCCAGAAGTAGG + Intronic
1037995069 8:23346231-23346253 CAGCCCCAAATGCCAGAAGCTGG + Intronic
1039970883 8:42320803-42320825 GAGCCCCATGGGCCGGAAGCAGG + Exonic
1044895939 8:96891396-96891418 GTGCCTAATTTGCCAGCAGCCGG - Intronic
1048224197 8:132568978-132569000 GAGCCCCAAGTTCCAGAAGCAGG - Intergenic
1050656233 9:7831724-7831746 GTAGTCAATTTGCCAGAAGCAGG + Intronic
1051230344 9:14949273-14949295 GAGCTGAAATTCCCAGAAGCTGG - Intergenic
1051356485 9:16243932-16243954 GAGCCCAGTTTGCAAGAACGAGG - Intronic
1052571669 9:30232681-30232703 GAGCCGACTGTGCCAGAAGGAGG - Intergenic
1053488935 9:38485458-38485480 GAGTCCAATCTGCCAGGAGTGGG - Intergenic
1057100467 9:92354339-92354361 AAGGCCAATTTGCCAGCAGCAGG - Intronic
1057669284 9:97074744-97074766 GAGTCCAATCTGCCAGGAGTGGG - Intergenic
1189363399 X:40370359-40370381 GAGCCCAAATTCCCCAAAGCGGG - Intergenic
1191920076 X:66246370-66246392 GAGACCATTGTGCCAGAAGCTGG + Intronic
1191941137 X:66482957-66482979 GTGCCCAATTTTCCAGCAGCAGG - Intergenic
1194091207 X:89583175-89583197 AAGCCCAATTTGCCAGGAAAGGG - Intergenic
1199488563 X:148373849-148373871 GACCCAAATCTGACAGAAGCTGG + Intergenic
1199689467 X:150297449-150297471 GAGACCACTGTGCCAGGAGCAGG - Intergenic
1200443848 Y:3239240-3239262 AAGCCCAATTTGCCAGGAAAGGG - Intergenic