ID: 970632074

View in Genome Browser
Species Human (GRCh38)
Location 4:17958232-17958254
Sequence CAGGAAAAAAACAGAATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 939
Summary {0: 1, 1: 0, 2: 5, 3: 77, 4: 856}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970632071_970632074 -6 Left 970632071 4:17958215-17958237 CCATCAAGAAGGTCCTTCAGGAA 0: 1
1: 0
2: 1
3: 31
4: 238
Right 970632074 4:17958232-17958254 CAGGAAAAAAACAGAATTGTGGG 0: 1
1: 0
2: 5
3: 77
4: 856

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970632074 Original CRISPR CAGGAAAAAAACAGAATTGT GGG Intronic
903529603 1:24020111-24020133 CAAAAAAAAAAAAGAATTTTTGG - Intergenic
904447154 1:30583704-30583726 CAACAAAAAAAGAGAATTTTAGG - Intergenic
904530584 1:31166056-31166078 CAGGAAAAAAAAAAAAAGGTGGG + Intergenic
904816814 1:33209370-33209392 CAACAAAAAAAGAGAATTTTAGG - Intergenic
907284989 1:53373973-53373995 AAGGAAATAATCAGAAATGTGGG + Intergenic
908576383 1:65464475-65464497 CAATAAAAAAAGAGAATTTTAGG - Intronic
909002508 1:70236105-70236127 CATGAAAAGGACAGAATCGTTGG + Intronic
909230579 1:73084064-73084086 CAACAAAAAAAGAGAATTTTAGG - Intergenic
909456772 1:75858716-75858738 CAAGAAAAAAAGAGAATTTTAGG - Intronic
909509537 1:76436488-76436510 CAGGTAAAAAATAAAAATGTTGG - Intronic
909771356 1:79426006-79426028 CAAGATAAATAAAGAATTGTTGG + Intergenic
909870008 1:80727466-80727488 CAAGAAAAACACAGAATTGAAGG - Intergenic
910175611 1:84427184-84427206 AAAAAAAAAAACAGAATTGAAGG + Intergenic
910306883 1:85774320-85774342 CAACAAAAAAAGAGAATTTTAGG - Intronic
910350849 1:86296060-86296082 CAGGAGAAATGCAGAATGGTGGG + Intergenic
910653569 1:89596947-89596969 CTGGAAACAGACAGAATGGTGGG + Exonic
910658630 1:89644988-89645010 CAGGATAAAATCAGACTAGTAGG + Intronic
910915437 1:92283168-92283190 CAACAAAAAAAGAGAATTTTAGG + Intronic
910925312 1:92392074-92392096 CAACAAAAAAAGAGAATTTTAGG + Exonic
910954400 1:92686089-92686111 CAACAAAAAAAGAGAATTTTAGG + Intronic
911217643 1:95213136-95213158 CAACAAAAAAAGAGAATTTTAGG - Intronic
911220319 1:95238618-95238640 AAGAAAAAAAACACAAGTGTAGG + Intronic
911243110 1:95486763-95486785 CAACAAAAAAAGAAAATTGTAGG + Intergenic
911736039 1:101337609-101337631 AAGGAAATAATCAGAATTTTGGG + Intergenic
911827565 1:102506628-102506650 CAACAAAAAAAGAGAATTTTAGG - Intergenic
911933392 1:103933694-103933716 CAAGAAACATACAGTATTGTGGG - Intergenic
912215262 1:107603471-107603493 CAGGAAGGAAAAAGACTTGTAGG + Intronic
912612583 1:111062986-111063008 CAGGAAAACAAAAGAATTCATGG - Intergenic
912875949 1:113359535-113359557 CAACAAAAAAAGAGAATTTTAGG - Intergenic
913144334 1:115975125-115975147 CAGGAAGAAAAGAAAATTATAGG + Intergenic
913239319 1:116815656-116815678 TAGGAAAAAACTAGAAATGTGGG - Intergenic
913418845 1:118641430-118641452 CAACAAAAAAAGAGAATTTTAGG + Intergenic
913490501 1:119375505-119375527 CAGGTAAAGAACACAATAGTTGG - Intronic
913512853 1:119577880-119577902 CAACAAAAAAATAGAATTTTAGG + Intergenic
913609241 1:120494140-120494162 CATGAAAAAAACAAAAATGGTGG + Intergenic
914204586 1:145516310-145516332 CATGAAAAAAACAAAAATGGTGG - Intergenic
914289347 1:146258642-146258664 CAAAAAAAAAAAAGAATTATAGG - Intergenic
914550383 1:148709395-148709417 CAAAAAAAAAAAAGAATTATAGG - Intergenic
914581951 1:149027699-149027721 CATGAAAAAAACAAAAATGGTGG - Intronic
914707595 1:150183508-150183530 CAGCTAAAAAACACAAGTGTTGG - Intergenic
914786387 1:150835999-150836021 CGGAAAAAAAAAAGTATTGTAGG + Intronic
914799947 1:150953526-150953548 CAAAAAAAAAAAAAAATTGTTGG + Intronic
914857252 1:151361834-151361856 AAAAAAAAAAAAAGAATTGTAGG + Intergenic
916209271 1:162346443-162346465 AAGGAAAAAAATAGAATTGTGGG + Intronic
916404920 1:164488857-164488879 AAAGAAAAAAAAAGGATTGTAGG - Intergenic
916469129 1:165105668-165105690 CAGCAAAAAAAGAGAATTTTAGG - Intergenic
916558677 1:165914470-165914492 CAGAAAAAAAAGAGACTTCTAGG - Intergenic
917203020 1:172537121-172537143 GAGGAAAAAAACATAATTAGTGG + Intronic
917224905 1:172771230-172771252 CAAGAAAAAATCAGAATTTGGGG + Intergenic
917333062 1:173902409-173902431 AAGGGAAAAAACAGACTGGTAGG - Exonic
917543770 1:175940861-175940883 CAGGAAAAACATAGAGTAGTGGG - Intergenic
917669820 1:177262767-177262789 CAGGAAGAAAAGGGAATAGTTGG + Intronic
917985631 1:180315297-180315319 AAGGAAAATAACTGAAATGTTGG - Intronic
918288561 1:183083117-183083139 CAGGTAAAGAAGAGAAGTGTTGG + Intronic
918371296 1:183864081-183864103 CAGGAAAAGAGCAGAAGAGTAGG + Intronic
918627649 1:186676275-186676297 AAGGAAGAAAACAGAAATGAAGG - Intronic
918679856 1:187340191-187340213 CAGGAAAAAAATTGAAAAGTTGG + Intergenic
918932739 1:190876741-190876763 CAGGAAAAAAACTCAATTAATGG + Intergenic
919231112 1:194775687-194775709 AAGGAAGACAACAAAATTGTTGG - Intergenic
919436926 1:197573642-197573664 CAACAAAAAAAGAGAATTTTAGG + Intronic
919877269 1:201878790-201878812 CAGGAAGAAAAAAGATCTGTTGG + Exonic
920273186 1:204782604-204782626 AAGCAAAAAAACTGAATTGATGG - Intergenic
920429019 1:205903172-205903194 CAACAAAAAAAGAGAATTTTGGG + Intergenic
920577041 1:207069043-207069065 AAGGAAAGAAAAAGAAATGTCGG - Intronic
920613178 1:207462398-207462420 CTGGAAAAAATCAGTGTTGTTGG + Intronic
920683993 1:208095295-208095317 CAGGGAAAAAGCAGAAATGGAGG - Intronic
921352348 1:214249111-214249133 CAGGAAAAAAAAAAAATTGGAGG + Intergenic
921527353 1:216234207-216234229 AAGGAAAAAAACCCAATTGTTGG - Intronic
921831202 1:219729715-219729737 CAACAAAAAAAGAGAATTTTAGG - Intronic
922326173 1:224530582-224530604 AAGAAAAAAAAAAGAAATGTAGG - Intronic
922433577 1:225581135-225581157 CAGAAAAAAAAGAAAAATGTGGG + Intronic
922689162 1:227673426-227673448 CAGAAATAAAACAAAATTGGAGG + Intronic
923473976 1:234315963-234315985 CAGGACAATAACAGGATTGAGGG + Intronic
923563626 1:235060338-235060360 AAGGAAGGAAACAGAATAGTAGG + Intergenic
923679646 1:236109282-236109304 CAGAAAAAAAAAAAAATTGTTGG + Intergenic
923978547 1:239294118-239294140 AAGGAAAAAAAAAGAAATTTGGG - Intergenic
924643368 1:245854745-245854767 CAGGAAAAACGCAGAAGTGCAGG + Intronic
924676743 1:246186096-246186118 CAGTAAAAAACCACAATTCTGGG - Intronic
924727838 1:246686689-246686711 CAGGAACAAATCACAATGGTGGG - Intergenic
924766263 1:247033538-247033560 AAGAAAAAAAAAAGAATTCTAGG + Intergenic
924883361 1:248187450-248187472 TAGGAAAAAAAAAGACTTGCTGG - Intergenic
1063165140 10:3454910-3454932 CAGGAAAAAATCATATTTCTTGG + Intergenic
1063789409 10:9425077-9425099 CAGGAAACAAACACACCTGTAGG - Intergenic
1063883929 10:10558485-10558507 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1064091869 10:12392391-12392413 CAGGAACAAAGTAGAATGGTAGG - Intronic
1064213532 10:13380943-13380965 AAGGTAAAGAACAGAATTTTTGG + Intergenic
1064437760 10:15326308-15326330 AACAAAAAAAAAAGAATTGTGGG - Intronic
1064505786 10:16028356-16028378 AAGGACAAAGACAGAATAGTTGG + Intergenic
1064555109 10:16540239-16540261 CAGTGAAAGAACAAAATTGTTGG + Intergenic
1064560868 10:16594406-16594428 CAGGAAAAAAAAAAAAATGCCGG - Intronic
1064826853 10:19413560-19413582 CATGAAAAAAAAAGGATTTTAGG + Intronic
1064975258 10:21107618-21107640 CAACAAAAAAAGAGAATTTTAGG - Intronic
1065003719 10:21360960-21360982 CAGGAAAGAAGCAGATTTCTTGG - Intergenic
1065034148 10:21620981-21621003 CAGGAAAAAAAAAAAATTCTTGG - Intronic
1065391527 10:25187323-25187345 CAATAAAAAAAGAGAATTTTAGG + Intronic
1065491428 10:26285962-26285984 CATGACAAAACCAGAATAGTAGG + Intronic
1065948767 10:30631773-30631795 CAGAAAAAGAACAAAATTGAAGG + Intergenic
1066438691 10:35416915-35416937 CAGGAAAGAAACTGAAGTCTAGG + Intronic
1066633487 10:37479251-37479273 CAAAAAAAAAAAAAAATTGTTGG + Intergenic
1067215396 10:44298224-44298246 CAGGAAAAGGACAGATTAGTGGG + Intergenic
1068749066 10:60570570-60570592 GGGGAAAAAAACAGAAATGTGGG + Intronic
1068777859 10:60887595-60887617 CAGGAAAACTACAGAAGTGCAGG + Intronic
1068788810 10:61005334-61005356 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1069008216 10:63341834-63341856 CAGCAGTAAAACAGAACTGTAGG + Intronic
1069440295 10:68422237-68422259 AAGGAAACAAACAGGATTGTTGG + Exonic
1069454368 10:68542029-68542051 CAAAAAAAAAAAAAAATTGTTGG + Intergenic
1069969653 10:72155711-72155733 CAGGAAGAAAACAGGATGGTGGG - Intronic
1070065007 10:73025174-73025196 CAACAAAAAAAGAGAATTTTAGG + Intronic
1070159708 10:73858830-73858852 AAGGACAAAAATAGAATTCTAGG - Intronic
1070713188 10:78698367-78698389 CAGGGCAAATACATAATTGTTGG - Intergenic
1070744660 10:78926306-78926328 CAGGAAAAAAAAAGACTTTGGGG - Intergenic
1071091129 10:81919881-81919903 CAAGAATAAAACACAATTGACGG - Intronic
1071207200 10:83295129-83295151 CACAAAAAAAAGAGAATTTTAGG + Intergenic
1071349985 10:84730833-84730855 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1071442230 10:85710173-85710195 TTGGAAAAAAACACAATTGAAGG + Intronic
1072067262 10:91883345-91883367 CAGGAAAAATATAGATTTCTGGG - Intergenic
1072275883 10:93822660-93822682 GAGGAAAAAAACAAAGTTGGAGG + Intergenic
1072520874 10:96228932-96228954 CTTTAAAAAAAAAGAATTGTAGG + Intronic
1072668488 10:97411951-97411973 AAGGAAAATAACAGAAATGTTGG + Intronic
1073018065 10:100417968-100417990 TAGGATAAAAAAAAAATTGTAGG + Intergenic
1073274385 10:102296742-102296764 AAAAAAAAAAAAAGAATTGTAGG + Intronic
1073332975 10:102682915-102682937 GAGGAAAAAAACAGGAATTTAGG + Intronic
1073499447 10:103922590-103922612 AAAAAAAAAAAAAGAATTGTAGG + Intergenic
1074193573 10:111159359-111159381 GAGGAAAAAACCATAACTGTTGG + Intergenic
1074591191 10:114814994-114815016 CAGGAAAAAAGCAAAAATGTGGG - Intergenic
1074895892 10:117777404-117777426 CAAAAAAAAAACAAAACTGTAGG - Intergenic
1075010434 10:118864362-118864384 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1075109545 10:119567072-119567094 CAGGAAGAAAAAAGAAATCTAGG + Intergenic
1075187114 10:120273030-120273052 TAGGAGAAAAGCAGAATTGGGGG + Intergenic
1075279164 10:121124604-121124626 CAGTAAAAAACCAGAAATGCAGG + Intergenic
1075520110 10:123137984-123138006 CAGGAACAAGACAAAATTTTCGG + Intergenic
1076119772 10:127926453-127926475 CAGAAGAAAAACAGAAATGTTGG - Intronic
1076340021 10:129738845-129738867 CAACAAAAAAAGAGAATTTTAGG + Intronic
1076448351 10:130535153-130535175 AAGGAAAAGAACAAAATTGGAGG - Intergenic
1077608615 11:3629130-3629152 CAGGAAAAAAATAGAATAAAGGG - Intergenic
1077933042 11:6753540-6753562 GAGGAAAAACAAAGAATTCTAGG - Intergenic
1078064603 11:8069873-8069895 CAGGCAAAAAAGAGAGTAGTGGG + Intronic
1078078081 11:8179812-8179834 GAGGAAAAAAATAGATTTTTAGG - Intergenic
1078158604 11:8820049-8820071 CAGGAAAAAATCATAAAGGTAGG + Intronic
1078560731 11:12369630-12369652 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1078903539 11:15663561-15663583 CAGGAAAAAAAAATCATTATGGG + Intergenic
1079578149 11:22028630-22028652 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1079807549 11:24953347-24953369 CAGGAAAAAAAAATACCTGTGGG + Intronic
1080033252 11:27684849-27684871 CAGCAAAAAAATAAAATTGTAGG - Intronic
1080138074 11:28881850-28881872 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1080309735 11:30875779-30875801 AAGGAAAAAAACAGAGATTTAGG + Intronic
1080322703 11:31032553-31032575 CAGTAAAAAAAAAAAATTGTAGG + Intronic
1080491182 11:32765998-32766020 CAACAAAAAAAGAGAATTTTAGG + Intronic
1081257429 11:40914238-40914260 CAACAAAAAAAGAGAATTTTAGG + Intronic
1082265413 11:50112558-50112580 CAGGAAAAAAAAAAAACTATTGG + Intergenic
1083116289 11:60462852-60462874 CAAGAAAAAGACAAAATTCTTGG + Intronic
1083249585 11:61457212-61457234 CAGGCAAAGAACAGATTTGAGGG - Intronic
1083383634 11:62290367-62290389 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1084069474 11:66724913-66724935 CAGGAGAAATGCAGAATTGGGGG + Intronic
1084164493 11:67368892-67368914 AAGGAAAAAAAAAGAACTATAGG - Intronic
1084205362 11:67588511-67588533 CAGAAAAAAAACCAAAGTGTTGG - Intergenic
1085138341 11:74115468-74115490 AAGGAAGAAAGCAGAATTCTAGG - Intronic
1085866516 11:80301150-80301172 CAGAAAAAAAAAAAAATAGTGGG + Intergenic
1085920489 11:80949470-80949492 TAGAAAACAAACAGAAATGTTGG + Intergenic
1086085704 11:82952817-82952839 CAACAAAAAAAGAGAATTTTAGG - Intronic
1086298739 11:85401029-85401051 CAAAAAAAAAAGAGAATTTTAGG + Intronic
1086558456 11:88139883-88139905 TAAGAAAGAAACAGAATTCTGGG - Intronic
1086738490 11:90337650-90337672 GAGAAAAAAATAAGAATTGTGGG + Intergenic
1086891270 11:92260896-92260918 CAGTAAAAAAACTTAAGTGTGGG + Intergenic
1087157295 11:94917963-94917985 CAGGAACAACAGAGTATTGTAGG + Intergenic
1087311451 11:96548704-96548726 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1087856659 11:103100045-103100067 CAGCAAAGAAACAGATTAGTAGG + Intergenic
1087859109 11:103131511-103131533 CAGGGAAAAAAAAGAATACTGGG - Intronic
1087990182 11:104739864-104739886 CAAGAAAAAAGCAGCACTGTTGG + Intergenic
1088382383 11:109208492-109208514 CCGAAAAAAAATAGAATTGGAGG - Intergenic
1088424748 11:109691278-109691300 AAGGAAATACACACAATTGTGGG - Intergenic
1088691024 11:112328064-112328086 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1089318614 11:117609601-117609623 GAGGAAAAAATCAGCATGGTTGG - Intronic
1089503163 11:118944731-118944753 CAGGAAAAAAAAAAAATTCCTGG - Intronic
1089907511 11:122057171-122057193 CTGGAAAAAAACATGATTTTAGG - Intergenic
1090576517 11:128110782-128110804 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1091150346 11:133322815-133322837 CAGGAAAAAAGCAGCAGGGTAGG - Intronic
1091190331 11:133688638-133688660 AAACAAAAAAACAGAATTGAAGG + Intergenic
1091342500 11:134827144-134827166 CAAAAAAAAAACACAACTGTAGG - Intergenic
1091927345 12:4364979-4365001 GAGACAAAAAACAGAAATGTTGG - Intergenic
1092109591 12:5949584-5949606 CAGGAAAAAAACAAAAATGGAGG - Intronic
1092436656 12:8452724-8452746 CAGAGCAAAAGCAGAATTGTGGG - Intergenic
1092661702 12:10745714-10745736 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1093137520 12:15470063-15470085 CATGAAAAAAACAGAAATTTTGG - Intronic
1093263601 12:16972512-16972534 AAGGAAACAAACAGAAATCTTGG - Intergenic
1093379784 12:18478611-18478633 CACTAAAATAATAGAATTGTGGG - Intronic
1093381276 12:18496873-18496895 CATGAAAAGTACAGCATTGTGGG - Intronic
1093419634 12:18960098-18960120 CAGGAAAGAAAAAGAAATATAGG - Intergenic
1093618262 12:21254688-21254710 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1094055493 12:26265291-26265313 CAGGAAATACAAAGGATTGTAGG + Intronic
1094099623 12:26747736-26747758 CAGGGAAATAAAAGCATTGTTGG - Intronic
1094100405 12:26756311-26756333 CAGAAAAAAAACAAAATGGATGG + Intronic
1094276387 12:28680887-28680909 CAGGTAAAATACAGGACTGTGGG - Intergenic
1094300694 12:28961924-28961946 TAGGAAAAAAACTGATTTATTGG + Intergenic
1094330443 12:29286021-29286043 CAGGATAAAATCAGAAACGTTGG + Intronic
1094642108 12:32285836-32285858 CAGGAAGAAAAAAAAATTGTAGG + Intronic
1094723367 12:33088128-33088150 CAGGAACAAATCACAATGGTGGG + Intergenic
1094723722 12:33090703-33090725 CAGGAACAAATCACAATGGTGGG + Intergenic
1094861025 12:34466500-34466522 CAACAAAAAAAAAGAATTTTAGG - Intergenic
1095287597 12:40433517-40433539 CAGGAAAAAGACAGTATTCATGG + Intronic
1095442454 12:42251357-42251379 CAACAAAAAAAGAGAATTTTAGG - Intronic
1095486176 12:42686909-42686931 CAGGAAAAAAAAAAAAATGGAGG - Intergenic
1095720543 12:45395532-45395554 CAACAAAAAAAGAGAATTTTAGG + Intronic
1095793467 12:46192383-46192405 CAACAAAAAAAGAGAATTTTAGG - Intronic
1095798806 12:46250028-46250050 CAACAAAAAAAGAGAATTTTAGG + Intronic
1095819484 12:46461718-46461740 CAGGAAAAAAACAAATATGCAGG + Intergenic
1096029573 12:48400699-48400721 CAATAAAAAAAGAGAATTTTAGG - Intergenic
1096389176 12:51216347-51216369 CAGGAACAAAACAGAATAAATGG + Intronic
1096643419 12:53013263-53013285 GAGGATAAAAACAGAACTGGTGG - Intronic
1096825150 12:54270276-54270298 CAAAAACAAAACAAAATTGTGGG - Intronic
1097035158 12:56119060-56119082 CAGGAAAAAAACAGAGACTTGGG - Intronic
1097152438 12:56988803-56988825 CAGGATAAAAACAGCAATGTTGG - Intergenic
1098035887 12:66302072-66302094 CATTAAAAAGACAGAATTCTAGG + Intergenic
1098167404 12:67712336-67712358 GATGAAGAAAACAAAATTGTTGG + Intergenic
1098200333 12:68047765-68047787 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1098382742 12:69886147-69886169 CAGGCAAAAAACAAAATTAGGGG + Intronic
1098462041 12:70742690-70742712 CTGGAAAAAAACAGAATTCGAGG + Intronic
1098853579 12:75626571-75626593 TAGCAAATAAAAAGAATTGTGGG + Intergenic
1099216972 12:79865009-79865031 CAACAAAAAAAGAGAATTTTAGG + Intronic
1099399865 12:82190312-82190334 CAGAAATAAAAAAGAAATGTTGG + Intergenic
1099409954 12:82312932-82312954 CAACAAAAAAAGAGAATTTTAGG - Intronic
1099431240 12:82588867-82588889 CAGTAAAAAAAGAAAATTTTAGG + Intergenic
1099664170 12:85605662-85605684 TAGGAAAAAAACACTATTTTCGG - Intergenic
1100608610 12:96171893-96171915 CAGGAAAAAAACAGGAACATTGG - Intergenic
1101161981 12:101987014-101987036 CAGGAAAAGAAGAGAATTGAGGG - Intronic
1101357782 12:103996742-103996764 CAGGACATAAACAGACTCGTGGG - Exonic
1101594910 12:106155628-106155650 AAACAAAAAAACAGAAATGTAGG - Intergenic
1101628286 12:106467903-106467925 CAATAAAAAAAGAGAATTTTAGG - Intronic
1102230739 12:111260463-111260485 CAGGAAAAAAAAAAAAGTATTGG + Intronic
1102385902 12:112509946-112509968 CAGGAAAAAAATGGGATTATTGG + Intergenic
1102473459 12:113173715-113173737 CAGGAAAATAACAGGATGGCAGG + Intronic
1102664540 12:114559591-114559613 CAGGAAGAAAACAAAATTTCAGG - Intergenic
1102986757 12:117284644-117284666 CAGGAAAGATACTGAACTGTGGG + Intronic
1103216192 12:119203092-119203114 AAAGGAAAAAACAAAATTGTAGG - Intronic
1103548130 12:121716144-121716166 CAGTAAAAAAAAAAAATTGCTGG + Intronic
1104289263 12:127454132-127454154 CTAAAAAATAACAGAATTGTTGG - Intergenic
1104541332 12:129668508-129668530 GAGGAAAAAAACAAACTTCTAGG + Intronic
1104592446 12:130095417-130095439 CAAAAAAAAAAAAAAATTGTGGG + Intergenic
1105340627 13:19521342-19521364 CAGAAAAAAAACAGACTTAAAGG - Intronic
1105395325 13:20028042-20028064 CTGGAATAAAGCAGAATTGTTGG - Intronic
1106187256 13:27420472-27420494 CAGGAAAAAGACAGATGTGAGGG - Intergenic
1106441690 13:29779739-29779761 CAGGTATAAAACAGTATTGTGGG + Intronic
1107102698 13:36611209-36611231 CATGAAAAAAACTGAGTTCTCGG - Intergenic
1107376140 13:39806870-39806892 CAGGAAAAAAAGAAAATTAATGG - Intergenic
1107398314 13:40041727-40041749 AAGGTTACAAACAGAATTGTAGG - Intergenic
1107517632 13:41147005-41147027 CAAAAAAAAAAAAGAATTCTTGG - Intergenic
1107900532 13:45009086-45009108 TAGGAAAATAACAGGATTGACGG + Intronic
1108085839 13:46792052-46792074 CATGAAAACAAAAGATTTGTTGG - Intronic
1108436271 13:50404594-50404616 GAGGAAAAAAACAGAGAGGTGGG + Intronic
1108792560 13:53989449-53989471 CAAATAAAAAACAGAATTTTTGG + Intergenic
1109099510 13:58162923-58162945 CAGAAAATAAAAATAATTGTAGG + Intergenic
1109493452 13:63134114-63134136 AAGGAAAAAAACAGAATCTCTGG + Intergenic
1109719869 13:66261765-66261787 CTGGAAAGAGACAGACTTGTTGG - Intergenic
1109804709 13:67423406-67423428 TAGGAAAAAAATAGAATTTGGGG + Intergenic
1110179541 13:72598553-72598575 GAGGAAATAAACAGACTGGTTGG + Intergenic
1110387769 13:74934554-74934576 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1110411733 13:75211519-75211541 AAGGAACAAAAGAAAATTGTGGG + Intergenic
1110632298 13:77723196-77723218 CAGTAACAAAACAAAATTCTTGG - Intronic
1111189943 13:84794037-84794059 GAGGAAAAAAACAAACTTCTGGG + Intergenic
1111409073 13:87850879-87850901 GAGGTAAAAAACAGAAGTGAGGG + Intergenic
1111437028 13:88224492-88224514 AAAAAAAAAAACAGAACTGTGGG - Intergenic
1111967357 13:94874466-94874488 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1112753139 13:102601783-102601805 AAAGACAAAAACAGAAATGTAGG - Intronic
1112881813 13:104116932-104116954 AAGTATAAAAACAGAATTTTAGG - Intergenic
1112886949 13:104185489-104185511 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114708997 14:24758494-24758516 CAGGAAAAAAACAGACATTTTGG + Intergenic
1115524904 14:34270322-34270344 CAGGAAAAAGAAAAAATTCTAGG + Intronic
1115818775 14:37191493-37191515 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1115892352 14:38045580-38045602 AAGGAGTAAAACAGAAATGTAGG + Intergenic
1116236178 14:42282185-42282207 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1116432364 14:44861252-44861274 CAAAAAAAAAAGAGAATTTTAGG - Intergenic
1116675836 14:47904729-47904751 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1117278306 14:54212161-54212183 CAGGAAGAAAAAAGAAAAGTTGG + Intergenic
1117521135 14:56552482-56552504 CAGGAAACAGACACACTTGTGGG + Intronic
1117633804 14:57721957-57721979 CTGGAAGAAAACAGGAGTGTTGG - Intronic
1117635959 14:57743766-57743788 CAACAAAAAAACACAATTTTAGG + Intronic
1117743366 14:58842237-58842259 CAGGAATAAATTATAATTGTGGG - Intergenic
1117900308 14:60525701-60525723 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1118569280 14:67176526-67176548 CAACAAAAAAAGAGAATTTTAGG - Intronic
1119473995 14:74916680-74916702 CAAGAAAAAAAAAAAATGGTTGG + Intronic
1119826302 14:77659856-77659878 CAGGAAAAAAAAAAAATCGGTGG + Intergenic
1120013357 14:79442692-79442714 AAAGAAAAAAACACTATTGTTGG + Intronic
1120051760 14:79875378-79875400 CAAAAAAAAAAAAAAATTGTAGG - Intergenic
1120201680 14:81544305-81544327 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1120245968 14:82007031-82007053 CATGAAAGAAATACAATTGTAGG - Intergenic
1120266436 14:82257061-82257083 CATGAAAAAAAAAGAATTGGGGG - Intergenic
1120574978 14:86170552-86170574 AAGGGAAAAAACATAATTATGGG + Intergenic
1121133771 14:91475175-91475197 CAGGAAAAAATCAGAATCATTGG + Intronic
1121237127 14:92400138-92400160 CTGGAAAAAATCAGAGTTGGAGG + Intronic
1121500522 14:94432674-94432696 GAGGAAAAGAACAAAATTGGAGG - Intergenic
1121785103 14:96652585-96652607 CAGGAATAAAACAAAATGGCAGG - Intergenic
1122302156 14:100737290-100737312 AAGACAAAAAAAAGAATTGTTGG + Exonic
1123171849 14:106380043-106380065 AAAGAAAGAAACAGAATTGAGGG - Intergenic
1123663031 15:22582010-22582032 CAGGAGAAAAACAGTATAGATGG - Intergenic
1124261241 15:28193928-28193950 CAGGAGAAAAACAGTATAGATGG + Intronic
1124675173 15:31678471-31678493 GAGGAAAAAAACGGTTTTGTGGG + Intronic
1124704422 15:31951148-31951170 CAGAGAAAAATTAGAATTGTTGG - Intergenic
1124882717 15:33657096-33657118 CAAGAAAAAAACACAAGTGTGGG - Intronic
1125042086 15:35200242-35200264 CAGGAAGATTACAGAATTCTGGG + Intergenic
1125071980 15:35565808-35565830 CAGGAAATACAGAGAATTATTGG - Intergenic
1125746842 15:42002893-42002915 CAGGAAAAAAATAGATTTATAGG + Intronic
1126310916 15:47315535-47315557 AAGGAAAAGAACAAAATTGGAGG - Intronic
1126405920 15:48322390-48322412 CAATCAAAACACAGAATTGTAGG - Intergenic
1126504909 15:49393804-49393826 CAAGAAACAAACAGAATTTATGG + Intronic
1127057474 15:55146852-55146874 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1127194049 15:56565095-56565117 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1127254375 15:57276776-57276798 AAGAAAAAAAAAAGAATTCTAGG - Intronic
1127864927 15:63024610-63024632 AAGGAAAAAAATATAACTGTTGG + Intergenic
1127903220 15:63356518-63356540 CAAAAAAAAAAAAGAATTGCTGG - Intronic
1127941794 15:63705533-63705555 TAGAAAAAAAACAGAAATGAGGG - Intronic
1128892849 15:71346287-71346309 CAGGAAAATAACAGAAGTGATGG + Intronic
1129097929 15:73228200-73228222 CATGAAAAATACAGATCTGTAGG + Intronic
1129605321 15:77022095-77022117 CAGGAAAACCACAGCATTTTTGG - Intronic
1130090988 15:80821261-80821283 CAGGAATAAAACAGAAATTAAGG - Intronic
1130110842 15:80963520-80963542 CAACAAAAAAAGAGAATTTTAGG + Intronic
1130366902 15:83249056-83249078 AAAGAAAAAAAAAGAGTTGTGGG + Intergenic
1130949002 15:88570976-88570998 CAGGAAAAAGACATCATTTTAGG + Intergenic
1131570328 15:93528487-93528509 TAGGAAAGAAACAGAATATTAGG + Intergenic
1132123023 15:99194306-99194328 AAGGAAAAGAACAAAATTGGAGG + Intronic
1132712563 16:1276109-1276131 CAGGAAGAAGACAGAGTAGTTGG + Intergenic
1132793146 16:1704989-1705011 TAGGACAAAAACAGAATCATTGG + Intergenic
1133274393 16:4628085-4628107 AAAAAAAAAAAAAGAATTGTGGG + Intronic
1133727510 16:8551152-8551174 CTGGTAAAAACCAGAATTCTAGG - Intergenic
1133842033 16:9418604-9418626 CATGAAAAAAACACATTTGAGGG - Intergenic
1134119696 16:11575101-11575123 CATGAAAAAAAAAGAACTTTAGG - Intronic
1134845884 16:17439923-17439945 CAGAAAAAATACAGAAGTGATGG + Intronic
1135086078 16:19475421-19475443 CAGAAAAAAAAAAAAAGTGTAGG + Intronic
1136960284 16:34839230-34839252 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1137242631 16:46670030-46670052 CAAGAAAAACACAGAATTCATGG - Intronic
1137264232 16:46855548-46855570 AAGGAAAAAAACAGAATGTTAGG - Intergenic
1137315388 16:47314953-47314975 AAGGAAAAAAAAAGAATTTTAGG + Intronic
1138380703 16:56600390-56600412 CAGGAAAAGAACAAAGTTGGAGG - Intergenic
1138481150 16:57304142-57304164 CAGGACATAAACAGAAATGGTGG - Intergenic
1138717519 16:59041287-59041309 CAGGAAAGAAACAGCATTATTGG - Intergenic
1138724905 16:59125317-59125339 CAAAAAAAAAAAAGAATGGTAGG - Intergenic
1139376290 16:66499642-66499664 CAACAAAAAAAGAGAATTTTAGG + Intronic
1139604011 16:68005028-68005050 AAGAAAAAAAACACAATTTTGGG - Intronic
1139748835 16:69096223-69096245 AAAAAAAAAAAAAGAATTGTGGG + Intergenic
1139748883 16:69096552-69096574 AAAAAAAAAAAAAGAATTGTGGG + Intergenic
1142066626 16:88066551-88066573 CTGAAAATAAACAGAATTTTAGG - Intronic
1142809628 17:2389259-2389281 CAGTAAAAAAAAAAAATTGAGGG - Intronic
1146441017 17:32895125-32895147 CAAAAAAAAAAAAAAATTGTCGG - Intergenic
1147202857 17:38815078-38815100 CAGGAAAAAAGAAGAAAAGTTGG - Exonic
1147802287 17:43101117-43101139 AAGGAAAAAAAAAGTAATGTTGG - Intronic
1148259453 17:46167249-46167271 CAGGAATTAAACAAAATTGCAGG + Intronic
1149191604 17:54069866-54069888 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1149196622 17:54129330-54129352 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1149283463 17:55133541-55133563 CAGGAAAAGAACAGAAAGGAAGG + Intronic
1149740924 17:59045028-59045050 TAGGAAAAAAAAAAAATTGCTGG + Intronic
1149769941 17:59312643-59312665 AAAAAAAAAAACAGAATTCTAGG - Intergenic
1149863307 17:60136438-60136460 CAGGAAGGAGACAGACTTGTAGG + Intergenic
1149987444 17:61358087-61358109 CAAAAAAAAAAAAAAATTGTGGG + Intronic
1150204088 17:63387853-63387875 CAGGAAAAAAACAGCAATACAGG - Intronic
1150520508 17:65862860-65862882 CACAAAAAAAGCAAAATTGTTGG - Intronic
1150982580 17:70158797-70158819 CAAGAAAAAAAAATCATTGTTGG - Intergenic
1151592841 17:75057892-75057914 AAGAAAAAATACAGCATTGTCGG + Intronic
1151692687 17:75696560-75696582 AAGAAAAGAAACAGAAATGTGGG + Intronic
1152333846 17:79688950-79688972 CAAAAAAAAAAAAGAAGTGTAGG + Intergenic
1152423103 17:80204624-80204646 CAGGAAAAAAAAAAAATTTCAGG + Intronic
1153064598 18:1031758-1031780 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1153140118 18:1961958-1961980 AAGGGATAAAACAGAGTTGTTGG - Intergenic
1153648282 18:7214854-7214876 CAGGAAATAAAAAGAATTAAAGG - Intergenic
1153874131 18:9351060-9351082 GAGCTAAAAAACAGAAATGTAGG - Intronic
1155564929 18:27123547-27123569 CAGAAAAAAAAGAGAAGTCTGGG + Intronic
1156124699 18:33889578-33889600 CATCAAAAAAAGAGAATTTTAGG + Intronic
1156678007 18:39554291-39554313 CAAAAAAAAAACAGAAGTGAGGG + Intergenic
1157050914 18:44163239-44163261 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1157057923 18:44252692-44252714 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1157425458 18:47580680-47580702 CAGGGAAAAAGCAGCAATGTGGG + Intergenic
1157435709 18:47667460-47667482 CTGGAAAAAAAAAGATTTCTGGG + Intergenic
1157585765 18:48800262-48800284 CAGGTATAAAACAGCAGTGTGGG - Intronic
1157842624 18:50973132-50973154 CAAGATAAAAACAGAAATGGGGG - Intronic
1158084334 18:53633000-53633022 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1158371180 18:56806307-56806329 CAGTTAAAACACAGAATGGTAGG - Intronic
1158471313 18:57739400-57739422 TAGGAAGGAAACAGAAATGTAGG - Intronic
1159160000 18:64631705-64631727 CAGGAACAAAAGAGAATTGGGGG - Intergenic
1159415200 18:68138093-68138115 CAGGCAACAAACAGAATGGGAGG - Intergenic
1159907711 18:74112478-74112500 CAGGAAAAAAACAGGAATACAGG + Intronic
1159979469 18:74759746-74759768 CAGGAAAATAAGAGAATTATGGG - Intronic
1160083864 18:75756013-75756035 CAGGAGAAGAACACAGTTGTGGG - Intergenic
1160259891 18:77282838-77282860 AAGAAAAAAAAAAGAATTCTTGG - Intergenic
1160440117 18:78883301-78883323 CAAAAAAAAAAAAAAATTGTAGG + Intergenic
1161461773 19:4401925-4401947 AAGGAAAAGAACAGTGTTGTAGG + Intergenic
1162237539 19:9320944-9320966 CAGGACAAATACAGAATGGAAGG - Intergenic
1162404576 19:10465999-10466021 CAGGAAAAAAAAAAAAAAGTAGG - Intronic
1162606875 19:11715856-11715878 CAGGAAAAAATGAAAGTTGTTGG - Intergenic
1163065687 19:14792416-14792438 CAGAAATAAAACTGGATTGTTGG + Intergenic
1163082665 19:14954779-14954801 CAGGAAGAAAACAGCAATGAGGG + Intronic
1163877974 19:19891336-19891358 CAGGAAGAAATCAGAACTGGTGG + Intronic
1163963535 19:20721087-20721109 CAACAAAAAAAGAGAATTTTAGG - Intronic
1164138905 19:22439960-22439982 CTGTAAAAAAGCAGAACTGTGGG - Intronic
1164529348 19:29036426-29036448 CAGCAATACAAAAGAATTGTTGG + Intergenic
1164556658 19:29258194-29258216 CTGCAAAAAAAGAGAATTTTGGG + Intergenic
1164658030 19:29938974-29938996 CAGAAAAAAAAAAAAATGGTAGG - Intronic
1165254708 19:34568817-34568839 CAGCATACAAAAAGAATTGTGGG + Intergenic
1165499416 19:36176090-36176112 AAGGAAAAGAAAAGAATTGCAGG - Intergenic
1165587816 19:36935625-36935647 AAGCAAAAATACAGAATTGAAGG - Intronic
1165722220 19:38087716-38087738 AAGGGAAAAAACAGCAGTGTTGG + Intronic
1166383215 19:42366081-42366103 AAAGAAAAAAAAAGAAGTGTTGG + Intronic
1167373577 19:49099427-49099449 AAGGAAAAAAAAAGTATTGTTGG + Intronic
1167440958 19:49508574-49508596 CAGAAAGAACACAAAATTGTTGG + Intronic
1167864487 19:52313436-52313458 CAAAAAAAAAAAAGAATTATAGG - Intronic
1168473751 19:56661367-56661389 CAGGAAGAAACCAGAATGATTGG + Intergenic
1168596656 19:57682980-57683002 CATGAAAAGAAAATAATTGTAGG - Intronic
925369550 2:3334735-3334757 CAGGAATAAAATAGAATTCTTGG + Intronic
925584813 2:5453985-5454007 CTGGAAAAAAAAACATTTGTGGG - Intergenic
925946594 2:8869830-8869852 CATGAACAAATCAGAAGTGTTGG - Intronic
926066595 2:9844978-9845000 CAGGAAAAAAAAAGAAAAGGAGG - Intronic
926100029 2:10109169-10109191 TAGAAAAAAGACAGAATGGTAGG + Intergenic
926546051 2:14241532-14241554 CAGAAGAAAAACAAAATAGTGGG - Intergenic
926555959 2:14358265-14358287 GAGGAAACAAACAGAATCATGGG + Intergenic
928299927 2:30116099-30116121 CAGGTAAAAACCAGAATGGTTGG - Intergenic
928487891 2:31751000-31751022 CAACAAAAAAAGAGAATTTTAGG + Intergenic
928725061 2:34162835-34162857 AAGGAAAAACACAGAAATATTGG - Intergenic
928837513 2:35565512-35565534 CAACAAAAAAAGAGAATTTTAGG - Intergenic
929203796 2:39267082-39267104 CAGGAAAAATAAAGTATTGCTGG + Intronic
929559422 2:42946491-42946513 AAAAAAAAAAAAAGAATTGTGGG + Intergenic
929792624 2:45034744-45034766 CAGGAACAAATCACAATGGTGGG + Intergenic
930078846 2:47431024-47431046 CAGGCTAATAATAGAATTGTTGG + Intronic
930211833 2:48647576-48647598 CAGGAAAAAAAAAACTTTGTGGG - Intronic
930361556 2:50386780-50386802 CAGGAGAAATACTGAATTGGTGG + Intronic
930955948 2:57203120-57203142 AAAAAAAAAAAAAGAATTGTCGG + Intergenic
931099151 2:58975938-58975960 GGGGAAAAATACAGAATTGATGG - Intergenic
931194522 2:60038534-60038556 CAACAAAAAAAGAGAATTTTAGG + Intergenic
931594846 2:63930204-63930226 CAACAAAAAAAGAGAATTTTAGG + Intronic
932377231 2:71247885-71247907 CAACAAAAAAAGAGAATTTTAGG - Intergenic
932791751 2:74659521-74659543 CAGGAAAAGAGCTGAATTCTTGG - Intronic
932936235 2:76105598-76105620 AAGAAAAATAACAAAATTGTTGG - Intergenic
933282691 2:80349547-80349569 CAGGAAAAAAAAAGGAAGGTGGG - Intronic
933468619 2:82690658-82690680 AAGGAAGAAACCAGAAATGTTGG + Intergenic
933619185 2:84517358-84517380 AAGGGAAAAAAAAGAATTGAGGG - Intronic
933696892 2:85226226-85226248 CAGCAAAAAAAGAGAATTTTAGG - Intronic
934017766 2:87907451-87907473 AAAAAAAAAAAAAGAATTGTGGG + Intergenic
934636707 2:95996033-95996055 TTGGAAAAAAACAATATTGTAGG + Intergenic
935229758 2:101085325-101085347 CAGGAACAGAACAGAAATGTGGG + Intronic
936100749 2:109576882-109576904 AAGGAAAAAAACAGAAAAGAGGG + Intronic
936649543 2:114410436-114410458 CAACAAAAAAAGAGAATTTTAGG - Intergenic
936880779 2:117248072-117248094 CAGATAAAATACAGAATTCTTGG - Intergenic
937130613 2:119509628-119509650 CAGTTAAAAAAAAGAATTGTTGG - Intronic
937275671 2:120682421-120682443 AAAGAAAAAAACTGAATTTTGGG - Intergenic
937315407 2:120928936-120928958 CAGGAAAAAAAGACACTAGTGGG - Intronic
937345132 2:121120779-121120801 CAGGAAAAATACAGCATTCTTGG - Intergenic
937401117 2:121584621-121584643 CAGAAAAAAAAAAGAATTGTGGG - Intronic
937431550 2:121842992-121843014 CAGGAGAGAAAGGGAATTGTTGG - Intergenic
938620986 2:133052921-133052943 CAGTAATTAAACAGAATGGTAGG + Intronic
939206591 2:139113185-139113207 CAGGAAAAAAAATGGAATGTGGG + Intergenic
939594561 2:144107795-144107817 CAACAAAAAAAGAGAATTTTAGG + Intronic
939697085 2:145340066-145340088 CATGAAATAGACAGAATTCTAGG - Intergenic
940634743 2:156284946-156284968 CAGGAAAAATACAAGATTTTGGG + Intergenic
940648936 2:156421388-156421410 CAGGAAAAGTACAGAACTGCAGG - Intergenic
940712885 2:157183812-157183834 AAAAAAAAAAAAAGAATTGTTGG - Intergenic
940741932 2:157518697-157518719 CAACAAAAAAAGAGAATTTTAGG + Intergenic
940897879 2:159098085-159098107 CAAGAAAACAACAAAATTGCTGG - Intronic
941214767 2:162692666-162692688 CAGGAAAAAAGCAGTACTTTAGG + Intronic
941441670 2:165545395-165545417 CAGGAAAGTAAAAGAATTGCTGG + Intronic
941669060 2:168271587-168271609 TAGAAAAAAAAAAGAAATGTAGG - Intergenic
941731235 2:168920540-168920562 CAGGAAAAAAAAAAAATAGAAGG - Intergenic
942085698 2:172441835-172441857 CAGGACAAGAAGGGAATTGTAGG - Intronic
942873912 2:180768771-180768793 CAACAAAAAAAGAGAATTTTAGG + Intergenic
943460959 2:188171099-188171121 CAGGAAAAAATGGTAATTGTGGG + Intergenic
943608343 2:190002572-190002594 AAGAAAAAAAACAGAATTCATGG + Intronic
943631161 2:190253957-190253979 CTGGAAAGAAGCAGAATTGGGGG - Intronic
943731420 2:191306947-191306969 CAGTAAACAAACTGAACTGTTGG - Intronic
944249263 2:197564934-197564956 CAACAAAAAAAGAGAATTTTAGG - Intergenic
944472922 2:200074243-200074265 CAGGAATAAAACAGCGTTCTGGG - Intergenic
944561401 2:200942199-200942221 AATGAAAAAAACAGAAATGTCGG + Intronic
944766839 2:202872287-202872309 CAGGAAAAAAACAAAAAGGAAGG + Intergenic
944773369 2:202936129-202936151 CATGAAAAAAAAGGAATTTTGGG - Intronic
945161530 2:206896666-206896688 CAACAAAAAAAGAGAATTTTAGG - Intergenic
945319205 2:208402105-208402127 CAGGAAGAAAACTGCCTTGTTGG - Intronic
945377829 2:209099808-209099830 AAAGAAAAAAATAGAATAGTTGG + Intergenic
945652855 2:212585965-212585987 CAACAAAAAAAGAGAATTTTAGG + Intergenic
946958976 2:224962903-224962925 CAGAAAAAAAATACAACTGTGGG - Intronic
946984501 2:225257029-225257051 CAGGAACAAGATACAATTGTGGG + Intergenic
947483904 2:230529118-230529140 CAACAAAAAAAGAGAATTTTGGG + Intronic
947559012 2:231129825-231129847 CAGGTAAAAAACAAAAAAGTAGG - Intronic
947685176 2:232077632-232077654 CAGGACAGAAACAGATTAGTGGG - Intronic
948841509 2:240652483-240652505 CAAGAAAAAAGTTGAATTGTTGG - Intergenic
1168912163 20:1457166-1457188 CATGTAAAAAACAGAATAATAGG - Intronic
1169618736 20:7480397-7480419 CAAAAAAAAAAAAAAATTGTGGG - Intergenic
1169666068 20:8037633-8037655 CAGTAAAAGGAAAGAATTGTTGG + Intergenic
1170484332 20:16800965-16800987 CAAGCAAAAACTAGAATTGTAGG + Intergenic
1170518043 20:17152400-17152422 CAGGAGAAAAATAAAACTGTTGG - Intergenic
1171318022 20:24212637-24212659 CAGGGAAGAAAATGAATTGTCGG + Intergenic
1171468061 20:25346334-25346356 CAGGAAGAACACAGATTTCTAGG + Intronic
1172413512 20:34744205-34744227 CAGGAATAAAAAATAATTTTGGG + Intronic
1172432126 20:34900852-34900874 AAGGAAAAAAATAAAAATGTAGG - Intronic
1172586814 20:36091493-36091515 CAGTGAAGAACCAGAATTGTTGG + Intronic
1173260094 20:41426544-41426566 CAGCAAAAGAACAGAAATGCAGG - Intronic
1173844723 20:46180730-46180752 CAAGAAAAAAAAAGATTTGTTGG - Intronic
1174180904 20:48673692-48673714 CAGGAAACAAACAGAGGTGGGGG - Intronic
1174228168 20:49021848-49021870 AAAAAAAAAAAAAGAATTGTTGG + Intronic
1174255974 20:49255346-49255368 CAGGAAAAAAAAAAAAGAGTAGG - Intronic
1174480096 20:50825219-50825241 AAAGGAAAAAACAGAACTGTAGG - Intronic
1174602681 20:51737605-51737627 GAGTGAAAAAAGAGAATTGTTGG + Intronic
1174721426 20:52817034-52817056 CAAGAAAAAAATAGAATATTAGG + Intergenic
1175161043 20:57007938-57007960 GAGGAAAAAAACAGAGTAGCTGG + Intergenic
1175270262 20:57728840-57728862 AAGGCAAATAACAGAATTGCTGG + Intergenic
1177030081 21:15971835-15971857 GAGACAAAAAACAGAAATGTAGG - Intergenic
1177320889 21:19519054-19519076 CAGGGCAAAAACAGAAGTGTAGG - Intergenic
1177366032 21:20138220-20138242 TAGTTAAAAAACAGAATTCTGGG - Intergenic
1177382467 21:20362557-20362579 CAGTTAAAAAATAGAAATGTAGG + Intergenic
1177556003 21:22689461-22689483 ATGAAAAAAAACAGAATTGAGGG - Intergenic
1178039533 21:28624447-28624469 GAGGATAAAAACAGAGTTGTGGG + Intergenic
1178080006 21:29053412-29053434 CAGGAAGAGAACAGTATTTTAGG - Intronic
1178388480 21:32178221-32178243 CAGGAATAAAAAAAAATTGCTGG - Intergenic
1178550317 21:33532661-33532683 AATGAAAAAAGCAAAATTGTAGG - Intronic
1179183588 21:39065521-39065543 CAGGATAACAAAAGAATTGATGG + Intergenic
1181326577 22:22053721-22053743 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1181445562 22:22970700-22970722 CAACAAAAAAACAGAATTTTAGG + Intergenic
1181785097 22:25221293-25221315 CAGGAGAAAAAGAGAATGTTTGG + Intronic
1182152320 22:28037208-28037230 CAACAAAAAAAGAGAATTTTAGG + Intronic
1182152622 22:28040278-28040300 CAACAAAAAAAGAGAATTTTAGG + Intronic
1182466944 22:30523037-30523059 CTGGAAAAAATCAAAAGTGTAGG + Exonic
1183622912 22:38985204-38985226 AAACAAAAAAACAGAACTGTGGG - Intronic
1184213277 22:43049791-43049813 GAAAAAAAAAAAAGAATTGTTGG + Intronic
1184317003 22:43702284-43702306 CAGCAAGATGACAGAATTGTCGG + Intronic
1184452119 22:44589392-44589414 GAGGAAAAAAACAATATTGAGGG - Intergenic
949256780 3:2057682-2057704 CAGGAGAGAAACACAATTTTGGG + Intergenic
949627498 3:5883591-5883613 CAAGAGAAAAAAAGAATTATAGG + Intergenic
949697246 3:6713197-6713219 CTGGGAAAAAAAAGTATTGTAGG + Intergenic
950260981 3:11543376-11543398 CAAGAAGGAAACAGAACTGTGGG - Intronic
950268180 3:11591141-11591163 CAGGAAAACAGCAGAATCCTGGG + Intronic
950996625 3:17504993-17505015 TGGGAAAAAAACAAAATTATAGG + Intronic
951065906 3:18265296-18265318 CAGTAAAAAGACAGAATTCCAGG + Intronic
951141964 3:19173004-19173026 AAGGAAAAAAACACAATCCTAGG + Intronic
951330650 3:21364479-21364501 CAGAATAAACACAGAATTCTGGG + Intergenic
951397709 3:22190084-22190106 CAATAAAAAAACAGTATTCTTGG + Intronic
951471274 3:23059066-23059088 CAACAAAAAAAGAGAATTTTAGG - Intergenic
951821008 3:26811872-26811894 CACAACAAAAACAGAATTTTAGG - Intergenic
952255381 3:31690688-31690710 CAGGAAAAAAATAGAATACCTGG + Intronic
952347117 3:32498420-32498442 AAGGAAATATACAGAACTGTGGG - Intronic
952448489 3:33407465-33407487 GAGGATAAAAACAAAATTGCTGG + Intronic
952484625 3:33798137-33798159 CAGGAAAAAAACAGGGTGCTTGG - Intergenic
952813671 3:37427805-37427827 CAACAAAAAAAGAGAATTTTAGG - Intronic
952856173 3:37772407-37772429 CAAAAAAAAAACAAAAATGTGGG + Intronic
953066141 3:39472943-39472965 AAGGAAAAAAAAATAATTGGGGG + Intronic
953067280 3:39485287-39485309 CAGCAAAAACACAAAAATGTAGG - Intronic
953523218 3:43663083-43663105 CAACAAAAAAAGAGAATTTTAGG + Intronic
953630806 3:44615200-44615222 CAAGTAGAAAATAGAATTGTGGG + Intronic
953843548 3:46408837-46408859 CAGGAAAAATGCAATATTGTAGG - Exonic
954183806 3:48901572-48901594 AAAGAAAAAAAAAGAATTATGGG + Intergenic
954282712 3:49594884-49594906 CAAAAAAAAAAAAAAATTGTAGG - Intronic
954596201 3:51827062-51827084 CATGAAAAAAGCAGAGTTGACGG + Exonic
955855795 3:63271964-63271986 AAGGAAGAAAAGAGAATTGGGGG + Intronic
955991702 3:64634676-64634698 CAGGAAGATCACAGAATCGTAGG + Intronic
956254903 3:67273163-67273185 AAAAAAAAAAACAGACTTGTGGG - Intergenic
956372248 3:68575606-68575628 CAGGAAAAAGAAAGAATTAAAGG + Intergenic
956973659 3:74555363-74555385 CAACAAAAAAAGAGAATTTTAGG - Intergenic
957166922 3:76686434-76686456 CAGGAAAATATTAGGATTGTTGG - Intronic
957353112 3:79051598-79051620 CAACAAAAAAAGAGAATTTTAGG + Intronic
958139598 3:89544419-89544441 TAGAAAAGAAACAGAAGTGTAGG + Intergenic
959253286 3:103975416-103975438 CAGCAAAAAAAGAAAATTTTGGG + Intergenic
959404531 3:105943995-105944017 CAGAACAAAACCTGAATTGTGGG + Intergenic
959817517 3:110692232-110692254 CAGGAAACAAAGTGAAATGTTGG + Intergenic
960007285 3:112793414-112793436 CAGGAAAACAAAAGACTTTTAGG - Intronic
960055828 3:113275812-113275834 GGGGAAAAAAACAGAATAGAAGG - Intronic
960296888 3:115955350-115955372 CAGGAAAAAATCAGGAGTGAGGG - Intronic
960640719 3:119820241-119820263 AAGGAAGTAAACAGAAGTGTTGG - Intergenic
960656595 3:120011151-120011173 CAGTAGAAAAACATAATTTTTGG - Intronic
960734255 3:120760875-120760897 CAACAAAAAAAGAGAATTTTAGG - Intronic
960737503 3:120796823-120796845 CAGGAAAGAAGCAGAATGCTTGG - Intergenic
960911678 3:122655364-122655386 CAACAAAAAAAGAGAATTTTAGG + Intergenic
961122769 3:124387006-124387028 AAGGAAAAAAACAAGAGTGTAGG - Intronic
961770154 3:129243581-129243603 CAGGAAAAAAACATATATTTTGG - Intergenic
962797573 3:138862433-138862455 AAGGAAGAAAACAGTAATGTTGG - Intergenic
963232136 3:142918591-142918613 AAGGAAAAGAACAAAATTGGAGG - Intergenic
963235575 3:142952749-142952771 CAGGAAAAAACAAGAAGAGTGGG + Intronic
963619417 3:147586743-147586765 CAGCAATAAAACTGAAGTGTTGG - Intergenic
964448044 3:156781297-156781319 GAGGAAAAAAACAGTATTAGAGG - Intergenic
964778033 3:160301329-160301351 CAGGAAAGGAAATGAATTGTGGG - Intronic
964802584 3:160571869-160571891 TTGGAGAAAAACAGAATTATAGG + Intergenic
964936628 3:162096360-162096382 TAGGAAAAATACAAAATTTTAGG + Intergenic
965446969 3:168785805-168785827 AAGGAGAAAAACAAAATTGGAGG + Intergenic
965750104 3:171966845-171966867 CAGGATGGAAACAGAATTGAGGG + Intergenic
965800965 3:172493700-172493722 CAACAAAAAAAGAGAATTTTAGG - Intergenic
965818615 3:172662418-172662440 CAACAAAAAAAGAGAATTTTAGG - Intronic
966114962 3:176450620-176450642 CAACAAAAAAAGAGAATTTTAGG - Intergenic
966830929 3:184007949-184007971 CAGGCAAAAGAAAGAGTTGTGGG - Intronic
967098158 3:186194128-186194150 CAGGAAGAAACCAGAACTGGGGG - Intronic
967333066 3:188311627-188311649 CAGAAAAAAAAAAGAAATGTTGG - Intronic
967455085 3:189675910-189675932 CTGGAAAAAAAAGGACTTGTGGG - Intronic
967629924 3:191733758-191733780 CCAGAAAAAAAGAGAATTGTAGG + Intergenic
967809178 3:193741867-193741889 GAGGAAGAAAACAAAATTGCCGG - Intergenic
967866779 3:194196554-194196576 CAAAAAAAAAAAAGAAATGTTGG + Intergenic
967899598 3:194435908-194435930 AAAGAAAAAAAAAGAACTGTAGG + Intronic
967957350 3:194887341-194887363 GAGGAAAAAAATGGTATTGTGGG - Intergenic
968014673 3:195318951-195318973 GAGGGAAAAAATAGTATTGTGGG + Intronic
968122655 3:196136560-196136582 CAGGAAGAAAACAACCTTGTTGG - Intergenic
968860308 4:3163376-3163398 CAACAAAAAAAGAGAATTTTAGG - Intronic
969976084 4:11103164-11103186 CAAAAAAAAAAGAGAATTTTAGG + Intergenic
970463001 4:16294390-16294412 AAGGATTAAAACAGAATTGAAGG - Intergenic
970632074 4:17958232-17958254 CAGGAAAAAAACAGAATTGTGGG + Intronic
970850754 4:20599664-20599686 CAGGAAAAAGGCAGAAATCTGGG + Intronic
971031754 4:22645142-22645164 CAGCAAAAAAAGAGGATTTTCGG + Intergenic
971168881 4:24212992-24213014 CAGGACAAAATCAGCCTTGTTGG + Intergenic
973112016 4:46408339-46408361 CAAGAAAAAAAGAGAATTTTAGG + Intronic
973237314 4:47919482-47919504 CAACAAAAAAAGAGAATTTTAGG - Intronic
973685625 4:53366683-53366705 TAGGAAGAAAATAGAATTGGAGG - Intergenic
973871010 4:55166507-55166529 CAACAAAAAAAGAGAATTTTAGG - Intergenic
974060368 4:57027954-57027976 CAAGCAAAAATCAGAATTTTAGG - Intronic
974246170 4:59321678-59321700 CCAGAAAAAAACAAAATTGTTGG - Intergenic
974272713 4:59673062-59673084 TAGGAGAAAAACAATATTGTTGG + Intergenic
974298816 4:60038951-60038973 AAGGAAAAAAATTGAATTGCAGG + Intergenic
974628878 4:64457738-64457760 CAGGAGAAAAACAGGATCCTGGG + Intergenic
975173746 4:71262856-71262878 AACAAAAAAAAAAGAATTGTTGG - Intronic
975430594 4:74285970-74285992 GAGGAAAAGAACATAATGGTTGG - Intronic
975464956 4:74698647-74698669 AAAAAAAAAAAAAGAATTGTAGG - Intergenic
975794519 4:77993072-77993094 CAAAAAAAAAAAAGAATTATTGG - Intergenic
975863322 4:78701045-78701067 TAGGTAAAAAACAGAAATATTGG - Intergenic
976735188 4:88301961-88301983 CAGAAAAAAAAAAAAATAGTCGG + Intergenic
976906696 4:90245463-90245485 CAGGAAAAAGACATTATTGTTGG + Intronic
977115194 4:93015692-93015714 TAGGAGTAAAACAGAATTGTGGG - Intronic
977116917 4:93040034-93040056 CAAGAATAAAACAGAATTTAAGG - Intronic
977326162 4:95577252-95577274 CAACAAAAAAAGAGAATTTTAGG - Intergenic
977532734 4:98219472-98219494 CAGGAAAAAAACAGATTTGAAGG + Intergenic
977666005 4:99648415-99648437 CATGAAAATAACAGTCTTGTGGG + Intronic
977771399 4:100865257-100865279 CAACAAAAAAAGAGAATTTTAGG - Intronic
977845727 4:101764378-101764400 CAGAAAAAAGAGAGAAGTGTGGG - Intronic
978073280 4:104497023-104497045 AAGGAAAACTACAGAATTCTTGG + Intergenic
978464872 4:108997665-108997687 CAACAAAAAAAGAGAATTTTAGG + Intronic
978769938 4:112444690-112444712 CAGGAAAAAAAAACAATTTGGGG + Intergenic
978876446 4:113645559-113645581 CAGGAAAGAAAGAGAAAGGTTGG - Intronic
979037404 4:115740807-115740829 AAGAAAAAAAACAGGATTGCAGG - Intergenic
979222941 4:118250296-118250318 CATGGAACAAATAGAATTGTTGG - Intronic
979310839 4:119201347-119201369 CAACAAAAAAAGAGAATTTTAGG + Intronic
979315034 4:119252183-119252205 CAACAAAAAAAGAGAATTTTAGG - Intronic
979323202 4:119348368-119348390 CAGGAAAACAAAAGAAGAGTAGG - Intergenic
979359761 4:119747482-119747504 CAAACAAAAAACAAAATTGTAGG + Intergenic
979782148 4:124666056-124666078 CATGAAAAGAACAGAATTTCTGG + Exonic
979841040 4:125440800-125440822 CAGGAAAAGCAAAGAATTTTAGG - Intronic
980199240 4:129633401-129633423 TAGGATTTAAACAGAATTGTAGG - Intergenic
980515736 4:133857103-133857125 CATGAAAAAAAAAGAATTGGAGG + Intergenic
980558420 4:134439594-134439616 CAACAAAAAAAGAGAATTTTAGG - Intergenic
981189451 4:141843810-141843832 CATGAGAGAAACAGAATTTTTGG + Intergenic
981200009 4:141969383-141969405 CAGCAAAAAATGAGAATTTTAGG + Intergenic
982015233 4:151146826-151146848 CAGTTAAAAAACAGAGTTGCTGG - Intronic
982084622 4:151821515-151821537 AAGGAAGAAAACGGAATTGCTGG - Intergenic
983241034 4:165233006-165233028 CAGGAAAACAAAAGAAGAGTAGG - Intronic
983244099 4:165267762-165267784 CAACAAAAAAAGAGAATTTTAGG - Intronic
983457600 4:167984483-167984505 CAACAAAAAAAGAGAATTTTAGG - Intergenic
983842261 4:172471915-172471937 AAAGAAAAAAACTGAATTGTTGG - Intronic
983879395 4:172915937-172915959 CAACAAAAAAAGAGAATTATAGG + Intronic
984327966 4:178276991-178277013 GAGAAAAAAAAAACAATTGTGGG - Intergenic
984368423 4:178828888-178828910 CACGACACAAACAGAATTATTGG - Intergenic
984615364 4:181890873-181890895 CAGGAAAACAATAGAATTTAGGG - Intergenic
985272567 4:188208055-188208077 CAGAAAAAAAACATAAAAGTAGG + Intergenic
986875766 5:12106769-12106791 CAGGTTAAAAGCAGAATTCTGGG + Intergenic
987431783 5:17843688-17843710 CAGGAAACAAATGGAATTCTTGG - Intergenic
987501360 5:18713891-18713913 CATGAATATAACAGAATTGATGG + Intergenic
987509342 5:18815490-18815512 GAGGAAAAAAACAGTTTTGTGGG - Intergenic
988187522 5:27886342-27886364 CAACAAAAAAAGAGAATTTTAGG - Intergenic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
989069049 5:37490953-37490975 CAGAAAGAAAACAGACTGGTGGG + Intronic
989092420 5:37747184-37747206 CAAGAAAAAAACAAAAAAGTGGG + Intronic
989143171 5:38222138-38222160 CAACAAAAAAAGAGAATTTTAGG + Intergenic
989222613 5:38985688-38985710 AAAAAAAAAAATAGAATTGTAGG - Intronic
989258434 5:39392203-39392225 CAGGCAGAAAACAGAATAGGAGG - Intronic
989357754 5:40563833-40563855 CAACAAAAAAAGAGAATTTTAGG - Intergenic
989583613 5:43056818-43056840 CAACAAAAAAAGAGAATTTTAGG + Intergenic
989860954 5:46374929-46374951 CAACAAAAAAAGAGAATTTTAGG + Intergenic
990050103 5:51487476-51487498 CAGGAAGAAAACATATTTTTGGG + Intergenic
990215080 5:53521810-53521832 CAGAAAAAAAAAAAATTTGTGGG - Intergenic
991145875 5:63302984-63303006 CAGTAAAAAAAATGAATTGGAGG - Intergenic
991622057 5:68555288-68555310 CAGGAGCAAAGCAGAATTGTGGG + Intergenic
992184189 5:74227817-74227839 TAGGAAAAAGACAAAATAGTAGG + Intergenic
992308498 5:75468380-75468402 GAGGAAAAAAAGAGAAGTGTAGG + Intronic
992655010 5:78900447-78900469 CAGTGTAAAAACAGAATTGAGGG + Intronic
992981829 5:82183317-82183339 CAGGAAAAAAAAAGAGATGGAGG - Intronic
993130750 5:83895499-83895521 CAGGAGAAGATCAGATTTGTGGG + Intergenic
993230286 5:85226657-85226679 CAGAAAAAGAACAGAACTCTTGG - Intergenic
993508564 5:88742607-88742629 GAGGAAAAAAAGAAAATTTTAGG - Intronic
993591897 5:89804585-89804607 CAACAAAAAAAGAGAATTTTAGG + Intergenic
993841377 5:92884155-92884177 CAGGAAAAGAAAGTAATTGTAGG + Intergenic
993875099 5:93297287-93297309 TAGGACAAAAACAGAAATCTTGG + Intergenic
993969543 5:94401234-94401256 CAAAAAAAAAAAAGAATTGTGGG - Intronic
994113953 5:96040821-96040843 CAACAAAAAAAGAGAATTTTAGG - Intergenic
994142518 5:96357780-96357802 CAACAAAAAAAGAGAATTTTAGG - Intergenic
994171094 5:96660818-96660840 CAGGAAAAACAAATGATTGTTGG - Intronic
994241061 5:97421879-97421901 CAAGAAATAACCAGTATTGTTGG - Intergenic
994552182 5:101249797-101249819 CATGATAAAAACAGAAAAGTAGG + Intergenic
994599922 5:101889680-101889702 CAACAAAAAAAGAGAATTTTAGG - Intergenic
994656271 5:102597002-102597024 AAGGAAACAAACTGACTTGTTGG - Intergenic
995053141 5:107729540-107729562 CAAGAAAAAAACAAAATCATTGG + Intergenic
995284662 5:110374038-110374060 CATCAATAAAACAGAATTGAGGG - Intronic
995383971 5:111568040-111568062 CAACAAAAAAAGAGAATTTTAGG - Intergenic
995498885 5:112781303-112781325 AAGGAAACAAAGAGAATTTTAGG + Intronic
995642643 5:114275284-114275306 CAACAAAAAAAGAGAATTTTAGG - Intergenic
995806862 5:116062903-116062925 GACGAAAAATACAGAATTTTAGG - Intergenic
995872937 5:116761592-116761614 CAGGAACAAATCACAATGGTGGG - Intergenic
996059486 5:119017199-119017221 CATGAACAAAACAGAATTCTTGG - Intergenic
996997860 5:129720589-129720611 CAGAAAAATAGCATAATTGTTGG + Intronic
997074714 5:130659214-130659236 CAGGTAAAACTCAGAACTGTTGG + Intergenic
997629616 5:135356955-135356977 CAGGAAAATAACTGCATTTTAGG - Intronic
997775942 5:136605200-136605222 CAGAAAGAAAAGAGAATTCTGGG + Intergenic
997940602 5:138154003-138154025 AAGGGTCAAAACAGAATTGTGGG - Intronic
998365932 5:141631160-141631182 CATGTGAAAAACAGAACTGTAGG + Intronic
998586691 5:143434365-143434387 CAGGAAGAAAACATTTTTGTGGG - Intronic
999079822 5:148832609-148832631 GGGGAAAAAAACAGATTTCTCGG + Intergenic
999171789 5:149601635-149601657 TAGACAAACAACAGAATTGTAGG + Intronic
999387674 5:151166552-151166574 ATGGAAAAAAACAGAATTTTAGG - Intergenic
1000174774 5:158740956-158740978 TAGTTAATAAACAGAATTGTTGG - Intronic
1000886165 5:166750327-166750349 CAGGAAGAAAATAAAAATGTGGG - Intergenic
1000904415 5:166946987-166947009 AAGCAATAAAACAGAATTGAAGG + Intergenic
1001105699 5:168852267-168852289 GAGTAAAAAAACAGAGATGTGGG - Intronic
1001792388 5:174469588-174469610 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1002152031 5:177241663-177241685 CAAGAGAAAATCAGAATTATTGG + Intronic
1002178436 5:177416329-177416351 CAGGCAAAAAAAGGAATTTTGGG - Intronic
1002511938 5:179725986-179726008 CAAAAAAAAAAAAAAATTGTTGG + Intronic
1002553679 5:180017625-180017647 CATTAAAAAAACAGAAATGCTGG + Intronic
1003203203 6:3982323-3982345 CAGGGAAAAAAAAAAACTGTCGG + Intergenic
1003234528 6:4283674-4283696 AAGGAAAAATGGAGAATTGTAGG + Intergenic
1003289085 6:4763517-4763539 CAGGAAAAAAATAAAAGTATTGG + Intronic
1003933083 6:10946156-10946178 GAGAAAGAAAACAGAATGGTTGG - Intronic
1004181830 6:13387308-13387330 CAACAAAAAAAGAGAATTTTAGG + Intronic
1004334172 6:14749158-14749180 CTGGAAAAAAACAGTATTTCAGG - Intergenic
1004440783 6:15651001-15651023 AAGCAAAAAAACAAAATTATTGG + Intronic
1004788687 6:18998943-18998965 GAGGAAGAAAGCAGAACTGTGGG - Intergenic
1005102261 6:22185021-22185043 AATGAAAAAAACAGAAATATTGG - Intergenic
1005249615 6:23929653-23929675 CAGGAAAGAAATGGAAATGTTGG - Intergenic
1005815125 6:29544874-29544896 CATGAAAATGACAGAATTGAGGG - Intergenic
1006336391 6:33423098-33423120 CAGGAGAAAAACAGAGAAGTTGG - Intronic
1006946744 6:37789613-37789635 CAAAAAAAAAAAAAAATTGTAGG + Intergenic
1007467144 6:42061028-42061050 GAGGAAAAAAACAAACTTCTAGG - Intronic
1007475500 6:42117039-42117061 CAGGAAAAGAAGAGAATCCTAGG - Intronic
1008131255 6:47721864-47721886 CAGGAAAAAAAAATTCTTGTAGG + Exonic
1008614974 6:53217983-53218005 CAAAAAAAAAAAAAAATTGTTGG - Intergenic
1009348436 6:62646104-62646126 GAGGAAAAAAACTGTTTTGTGGG + Intergenic
1009483692 6:64193470-64193492 CAGGAAAAAAAAAGATTAGCCGG - Intronic
1009672130 6:66768893-66768915 CAGTAAAATACCAGAAATGTAGG - Intergenic
1009876671 6:69514494-69514516 GTGGAAAAAAACAAAACTGTTGG + Intergenic
1010044892 6:71430052-71430074 TAGGAAAACAACAGAAAGGTAGG + Intergenic
1010086070 6:71919404-71919426 AAGGAAAAAAAAACAATTATGGG + Intronic
1010106175 6:72170632-72170654 CAGAAACAAAACATAATGGTAGG - Intronic
1010251259 6:73709632-73709654 CAACAAAAAAAGAGAATTTTAGG + Intronic
1010280130 6:74013731-74013753 CAGGAAAAAAAAAGAGAGGTAGG - Intergenic
1010463491 6:76140236-76140258 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1010719897 6:79271039-79271061 CAGGAAAGCAACAGAAATGGAGG + Intergenic
1011138183 6:84122257-84122279 CAAGAAAAAAAGAGAACTGCAGG + Intergenic
1011273906 6:85609035-85609057 CATAAAAGAAACAGACTTGTGGG - Intronic
1011454167 6:87529035-87529057 AAGCAAGAAAACAGAATTCTAGG + Intronic
1012035317 6:94130038-94130060 CAACATAAAAATAGAATTGTAGG - Intergenic
1012337242 6:98076535-98076557 CATCAAACAAACAAAATTGTGGG - Intergenic
1013436959 6:110119731-110119753 CAACAAAAAAAGAGAATTTTAGG + Intronic
1013724982 6:113083532-113083554 CACCAAAAAAAATGAATTGTTGG - Intergenic
1013848840 6:114488927-114488949 AAAGAGAAAAACAGAATGGTTGG - Intergenic
1013905810 6:115217849-115217871 CAGCAAAAAAACAAAGCTGTAGG + Intergenic
1014977014 6:127900025-127900047 CAGGAAAATAACTTAACTGTTGG - Intronic
1015237344 6:130986437-130986459 AAGAAAAAAAAAAGAACTGTTGG + Intronic
1015536390 6:134271311-134271333 CAAAAAAAAAAAAAAATTGTGGG + Intronic
1016333566 6:142979813-142979835 CAACAAAAAAAGAGAATTTTCGG - Intergenic
1016335199 6:142997436-142997458 CAACAAAAAAAGAGAATTTTCGG + Intergenic
1016938927 6:149468805-149468827 CAGGCAAGAAAGAGAATGGTGGG - Intronic
1017085267 6:150707657-150707679 CATTAAAAAAACAGATTTTTGGG - Intronic
1017231325 6:152077097-152077119 GAGGAAAAAAACAGTTTTGTGGG + Intronic
1017231921 6:152082153-152082175 CAACAAAAAAAGAGAATTTTAGG + Intronic
1017836172 6:158180322-158180344 CAACAAAAAAAGAGAATTTTAGG - Intronic
1018325545 6:162663866-162663888 AATGAAAAAAAAAGTATTGTGGG - Intronic
1018771071 6:166971890-166971912 TAGAATAAAAACAGAAATGTAGG - Intergenic
1019006684 6:168803644-168803666 CAGGAAGAAATCAGCATTTTTGG + Intergenic
1019229632 6:170548499-170548521 CAGGTAAAAAAAAAAAGTGTGGG + Intronic
1020178503 7:5902358-5902380 AAATAAAAAAACAGAAATGTGGG + Intronic
1020185264 7:5954137-5954159 CAAAAAAAAAAAAAAATTGTGGG - Intronic
1020200609 7:6076871-6076893 CAAGAAAAAAAAAAAATTGCTGG - Intergenic
1020304421 7:6822641-6822663 AAATAAAAAAACAGAAATGTGGG - Intronic
1020385872 7:7601763-7601785 CAACAAAAAAAGAGAATTTTAGG + Intronic
1020810311 7:12843226-12843248 CAACAAAAAAAGAGAATTGTAGG + Intergenic
1021087756 7:16443391-16443413 AAGGAAAAGAACAAAATTGGAGG + Intergenic
1021151450 7:17156202-17156224 CAGGAAAAAAATACAATTTAAGG + Intergenic
1021538166 7:21728228-21728250 AAAAAAAAAAAAAGAATTGTGGG - Intronic
1022556654 7:31305032-31305054 CATGATAAATTCAGAATTGTAGG + Intergenic
1022604899 7:31803058-31803080 AAGAATAAAAACAGAATTGTAGG - Intronic
1022711938 7:32859425-32859447 CTGGAAAAAAACATAATTTGTGG - Intergenic
1023065365 7:36372322-36372344 GAGGAAAAAAAAAGAAATCTAGG + Intronic
1023340415 7:39213574-39213596 CAGGAAAAAAACAGATTACCTGG - Intronic
1023421604 7:39985834-39985856 CAGGAAAAATACAGTGTTATTGG + Intronic
1023490502 7:40734721-40734743 CTGCAAAAAAATAGAATGGTTGG + Intronic
1023548652 7:41345230-41345252 CAGGAAAAAGACTGAAAGGTTGG + Intergenic
1023576479 7:41633754-41633776 CAGGTGAAAAATATAATTGTAGG - Intergenic
1023585784 7:41728142-41728164 CAGGAGAAAAAGAAAATTGCTGG - Intergenic
1023813410 7:43929815-43929837 GGGAAAAACAACAGAATTGTAGG + Intronic
1024242012 7:47442979-47443001 CAGGAAAACATCTGTATTGTTGG - Intronic
1024679684 7:51672527-51672549 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1025563232 7:62398198-62398220 CAGGAAAAGAACAGAAGTGTGGG - Intergenic
1025594124 7:62902976-62902998 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1026368102 7:69670282-69670304 CAGAAAAATCACAGAATTTTAGG - Intronic
1026841189 7:73670807-73670829 CAGGAAAAAAAAAAAAAAGTGGG + Intronic
1027286360 7:76649587-76649609 CAAAAAAAAAAAAGAACTGTAGG - Intergenic
1027443074 7:78241333-78241355 CATGAAAGAGACAGAATTCTGGG - Intronic
1027841189 7:83314069-83314091 AAGGAAAAAAAAAGAATTTAAGG - Intergenic
1028150183 7:87363301-87363323 CATGAAAAAATCAGAATTCATGG + Intronic
1028412665 7:90547844-90547866 CAACAAAAAAAGAGAATTTTAGG - Intronic
1028836745 7:95382893-95382915 CAACAAAAAAAGAGAATTTTAGG + Intronic
1028877785 7:95842818-95842840 CAGCAAAAAAACAGAATAGGAGG - Intronic
1029338410 7:99922265-99922287 GAGGAAAAAATCAGACTTGAAGG + Intergenic
1029409871 7:100402201-100402223 AAAGAAAAAAAGAGAATTGGGGG - Intronic
1030202805 7:106922492-106922514 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1030211850 7:107004465-107004487 AAACAAAAAAACAGCATTGTTGG + Intergenic
1030331408 7:108275188-108275210 CAGCAAAAAAAGAGAATTTTAGG - Intronic
1030368337 7:108671388-108671410 AATGATAAAAACAGAATTGCTGG + Intergenic
1031484141 7:122308152-122308174 CAGCAAAAAAATAGGATTATAGG - Intronic
1031551313 7:123116585-123116607 AAGGATAAAAACAGGATTCTGGG - Intronic
1032024739 7:128432038-128432060 CAGAAAAGAAACAGAAATGGTGG - Intergenic
1032346050 7:131117942-131117964 TAGGACAGAAACAGAATTGCAGG + Intronic
1032454346 7:132061312-132061334 CAGGAAAAATATATAATGGTAGG + Intergenic
1033005652 7:137559053-137559075 AAAAAAAAAAAAAGAATTGTAGG - Intronic
1033818577 7:145106143-145106165 CAAGATAAACACAGAAATGTAGG + Intergenic
1033856519 7:145568171-145568193 CAGCAAGAAAACAGGGTTGTTGG - Intergenic
1034518454 7:151600396-151600418 TAGGAAATATACAAAATTGTGGG - Intronic
1035486348 7:159229193-159229215 AAGAAAAAAAAAAGAATTCTGGG + Intergenic
1036804180 8:11817319-11817341 CAATAAAAAAAGAGAATTTTAGG - Intronic
1037074660 8:14699596-14699618 CAAAACAAAAACAGATTTGTGGG + Intronic
1037486938 8:19356703-19356725 CAGGAAAAGAGGAGAATTGTGGG + Intronic
1037722687 8:21458444-21458466 CAGTAAAAATACAGTATTATGGG + Intergenic
1037978545 8:23232620-23232642 CAGGAAATAAACAGAATTGAAGG + Intergenic
1037984463 8:23279144-23279166 GAGGAAAAAAACAAAATTACAGG - Intronic
1038283131 8:26183450-26183472 AAGGAAATGAACAGAATTTTGGG - Intergenic
1038846378 8:31233713-31233735 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1039154889 8:34543911-34543933 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1039209838 8:35201561-35201583 CAAGAAAAAAGGAGAATGGTAGG + Intergenic
1039646581 8:39290829-39290851 CAGGAGAAAAATAGAATAGGAGG - Intergenic
1039840148 8:41287162-41287184 CAGGAAGAAAACAGATGTGAGGG - Intronic
1040068014 8:43164365-43164387 CAAAAAAAAAAAAGAATTGCTGG - Intronic
1040916459 8:52570277-52570299 CAGGAAACAAACAGGAGTGTTGG + Intergenic
1041390707 8:57345004-57345026 CAGGAAATACACAGGAGTGTTGG - Intergenic
1041815561 8:61966766-61966788 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1041838098 8:62240117-62240139 CAGCAAAAAAAGAAAATTTTAGG - Intergenic
1042702117 8:71626642-71626664 CAGGAAAAAAAAATACTGGTGGG + Intergenic
1043845167 8:85154966-85154988 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1044024367 8:87150206-87150228 CAGGTAGAAAACAGCTTTGTAGG + Intronic
1044155768 8:88844680-88844702 CAAAAATAATACAGAATTGTGGG + Intergenic
1044272901 8:90267784-90267806 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1044521281 8:93202147-93202169 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1045371338 8:101526505-101526527 AAGGAAAAAAAGAAAATTTTTGG - Intronic
1045552537 8:103185354-103185376 GAGGAAAAAAATAGAAAAGTAGG - Intronic
1045622996 8:104004709-104004731 CAGAAAAAAGACAGAATGATTGG + Intronic
1045985889 8:108249368-108249390 CAGGGTAAAAACATGATTGTTGG + Intronic
1046363901 8:113200191-113200213 CAGGAAAAAAAAAGAATAAGAGG - Intronic
1046580235 8:116083403-116083425 CAAGAAAAAAATAAAATTGTGGG + Intergenic
1046643823 8:116762952-116762974 AAGGAAAAAAAAAGAATTCTGGG + Intronic
1047187530 8:122647341-122647363 CAGGCAAATGACAGAGTTGTGGG - Intergenic
1048210642 8:132451615-132451637 CATGCAATAAACAGAAATGTAGG + Intronic
1048286178 8:133143377-133143399 CAGGAATAAAATAGAATCGTGGG + Intergenic
1048469977 8:134696914-134696936 CAAAAAAAAAAAAAAATTGTTGG - Intronic
1050224904 9:3442374-3442396 CATCAAAAAAACAAAATTGAAGG + Intronic
1050352283 9:4751764-4751786 CAGGAAAAGACCAAAATTGGAGG + Intergenic
1050368680 9:4898526-4898548 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1050390334 9:5136311-5136333 CAACAAAAAAAGAGAATTTTAGG + Intronic
1050419301 9:5446619-5446641 GATGAAAAGAAGAGAATTGTGGG - Intergenic
1050566298 9:6887475-6887497 CAGAAAAGAAACAGAAAGGTGGG + Intronic
1050662051 9:7893320-7893342 CAGGAAAAGAACTGAATGGAAGG + Intergenic
1050692992 9:8249406-8249428 CATGAACAAAACAGAACTCTTGG + Intergenic
1050992721 9:12173286-12173308 AAGGAAAAACAAAGAATTCTAGG - Intergenic
1051155582 9:14140920-14140942 CAGAGAAAAAACAGAAATGCTGG + Intronic
1051309146 9:15750507-15750529 CAACAAAAAAAGAGAATTTTAGG + Intronic
1051615554 9:19002435-19002457 CAACAAAAAAAGAGAATTTTAGG + Intronic
1051872357 9:21753296-21753318 CAGCAAAAAAAAAGAAATCTTGG - Intergenic
1051918641 9:22237558-22237580 CACTAAAAAAAAAGAAATGTGGG - Intergenic
1051996700 9:23225759-23225781 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1052017340 9:23484413-23484435 CAGGAAAAAAAAAAAAATGCTGG - Intergenic
1052551612 9:29957543-29957565 CAGGAAAGAAAAAGATTTATAGG + Intergenic
1052559613 9:30068429-30068451 GAGCAAAGAAACAGAAATGTAGG + Intergenic
1052631989 9:31053088-31053110 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1053264059 9:36697632-36697654 CAGGAAGACAAGAGAATGGTGGG + Intergenic
1053594593 9:39546771-39546793 CAGGAAAGAAAGAGGATGGTAGG + Intergenic
1053852370 9:42301804-42301826 CAGGAAAGAAAGAGGATGGTAGG + Intergenic
1054571668 9:66818201-66818223 CAGGAAAGAAAGAGGATGGTAGG - Intergenic
1054998400 9:71420220-71420242 CAGGAAAAGAAGAGAATTAGGGG + Intronic
1055259729 9:74419336-74419358 GAGGAAAAAAAAAGAAATGGAGG + Intergenic
1055546652 9:77381517-77381539 CAGTAACAAAAAAGAACTGTTGG + Intronic
1055606017 9:77971320-77971342 CAACAAAAAAAGAGAATTTTAGG + Intronic
1055652319 9:78418559-78418581 AAGGACAAAAACAGAAATTTTGG - Intergenic
1056648752 9:88439081-88439103 CACACAAAACACAGAATTGTAGG + Intronic
1057159376 9:92876228-92876250 CAGGAAAAAAACAGAAAAAATGG + Intronic
1057361454 9:94377171-94377193 CAGGAAAAACACATAATTCAGGG - Intronic
1057661907 9:97010999-97011021 CAGGAAAAACACATAATTCAGGG + Intronic
1058248201 9:102657331-102657353 CAGGAAAAAAAGAGAAATATGGG + Intergenic
1058473797 9:105309125-105309147 CAGGAAGGAAACAGAAGTATTGG + Intronic
1059506621 9:114805025-114805047 CAAGAAGAAAACATAATTCTTGG - Intronic
1059794588 9:117678843-117678865 AGGGGAAAAAACAGAATTCTTGG + Intergenic
1060037807 9:120272509-120272531 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1060156476 9:121323668-121323690 CAGGAAAAGAACAGTAGTGGGGG - Intronic
1060324819 9:122603864-122603886 AAGGAAAAAAAAAGTATTGTTGG - Intergenic
1060572702 9:124657347-124657369 CAAGAAATAAACAGAACTATTGG + Intronic
1060638035 9:125215088-125215110 CAGGAAAAAGACAGAAAGCTGGG - Intronic
1062558517 9:137128438-137128460 GATGAATAAAACAGATTTGTAGG - Intergenic
1186290582 X:8093462-8093484 CAGCAAAACAACAGAAATGCCGG + Intergenic
1186659758 X:11657762-11657784 AAGGAAAAACACAGAACTGTAGG + Intronic
1186720388 X:12297502-12297524 GTGGGAAAAAACAGAATTGTGGG + Intronic
1186793096 X:13017941-13017963 CAGACAAAAAACAAAATTATAGG + Intergenic
1186905494 X:14106397-14106419 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1187385432 X:18844274-18844296 CAGGACAAATACAGAATTTGAGG - Intergenic
1188039890 X:25359444-25359466 CTTAAAAAAAACAGAAGTGTGGG - Intergenic
1188133130 X:26462452-26462474 AAGAAAAAAATCAGAATTTTTGG + Intergenic
1189148193 X:38676615-38676637 CAGGAAGTAAACACAATAGTAGG - Intronic
1189676576 X:43467122-43467144 CAGGCAAAACACAGAATGGTTGG - Intergenic
1189978084 X:46482501-46482523 AATAAAAAAAACAGAATTTTAGG - Intronic
1190503918 X:51106926-51106948 GACCAAAATAACAGAATTGTGGG + Intergenic
1191047943 X:56159337-56159359 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1191064951 X:56338096-56338118 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1191096386 X:56677373-56677395 CAATAAAAAAAGAGAATTTTAGG + Intergenic
1191625225 X:63263524-63263546 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1191796621 X:65028417-65028439 CAGGAAAAGTACAGAAGTCTTGG + Intronic
1191864257 X:65691144-65691166 TAGGAAAAAGACATAATTCTTGG - Intronic
1191996630 X:67102758-67102780 CAGGAAAAAATTGGAAATGTAGG - Intergenic
1192122496 X:68469880-68469902 CCAAAAAAAAAAAGAATTGTTGG + Intergenic
1192258308 X:69485081-69485103 CAAAAAAAAAAGAGAATTTTAGG + Intergenic
1192684047 X:73285032-73285054 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1192685964 X:73305426-73305448 TTGGAAAAACACAGTATTGTGGG + Intergenic
1192997184 X:76524267-76524289 CAATAAAAAAAGAGAATTGTAGG - Intergenic
1193019584 X:76777211-76777233 CATAAAAAAAAGAGAATTTTAGG - Intergenic
1193060744 X:77204443-77204465 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1193413277 X:81191003-81191025 AAGGAAAAGAACAGAGTTGGAGG - Intronic
1193477566 X:81985282-81985304 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1194185377 X:90768655-90768677 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1194266214 X:91756353-91756375 CAAGCAAAAAAGAGAATTTTAGG + Intergenic
1194580193 X:95662368-95662390 CAGGAAGAAAATAGAAATGTGGG - Intergenic
1195123098 X:101776467-101776489 CAGGAAAAAAACAGTCTTTAAGG - Intergenic
1195332465 X:103815132-103815154 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1195662835 X:107398079-107398101 AATGAAAAAAACTGAAATGTTGG - Intergenic
1195767056 X:108307046-108307068 AGGGAAAAAAAGAGAAGTGTTGG + Intronic
1195988667 X:110660576-110660598 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1196283705 X:113854893-113854915 CTGGAAACAAAAAGAATTTTAGG + Intergenic
1196346634 X:114668683-114668705 CAGGTAAAAAAAATAATTCTTGG - Intronic
1196717114 X:118822905-118822927 AAGGAAAAGAAAAGAAATGTAGG - Intergenic
1197288157 X:124620999-124621021 AAAGAATAAAACAGAATTATAGG + Intronic
1198122373 X:133606932-133606954 CAGGATAAATTCAGAATTTTTGG + Intronic
1198663821 X:138999877-138999899 CAACAAAAAAAGAAAATTGTAGG + Intronic
1198725500 X:139672765-139672787 CAACAAAAAAAGAGAATTTTAGG - Intronic
1198741370 X:139846930-139846952 CAAAAAAAAAAAAAAATTGTGGG + Intronic
1198775518 X:140175103-140175125 CATGTTAACAACAGAATTGTTGG - Intergenic
1198878299 X:141251260-141251282 CAGCAAAAAAAGAAAATTTTAGG - Intergenic
1200532001 Y:4350741-4350763 CAACAAAAAAAGAGAATTTTAGG + Intergenic
1200971477 Y:9157138-9157160 CAGGAAAGAAACACAGTTGAAGG + Intergenic
1201970998 Y:19794820-19794842 CAACAAAAAAAGAGAATTTTAGG - Intergenic
1202060818 Y:20885992-20886014 CAACAAAAAAAGAGAATGGTAGG + Intergenic
1202062972 Y:20907442-20907464 CAGAAATGAAACTGAATTGTTGG - Intergenic
1202139543 Y:21707156-21707178 CAGGAAAGAAACACAGTTGAAGG - Intergenic