ID: 970632785

View in Genome Browser
Species Human (GRCh38)
Location 4:17970191-17970213
Sequence CTATTTCTGGATCTTCTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970632785 Original CRISPR CTATTTCTGGATCTTCTATC TGG (reversed) Intronic
905009793 1:34739531-34739553 CTCTTTCTGGATCTTCCTTGCGG + Intronic
905855589 1:41309730-41309752 CCATCTCTGGATCCTTTATCTGG + Intergenic
906213019 1:44022631-44022653 CAAGCTCAGGATCTTCTATCTGG - Intronic
907532664 1:55116863-55116885 CTTTTTCTGGCTTTTGTATCAGG - Intronic
907611616 1:55876781-55876803 CTTTTTCTGCCTCTTCTCTCTGG - Intergenic
907977767 1:59448787-59448809 TTATTTCTTGATGCTCTATCTGG - Intronic
908921715 1:69202258-69202280 GTGATTCTGGATCTTCAATCTGG + Intergenic
909119573 1:71584508-71584530 GTATTCCTGGATCTTTTATTAGG + Intronic
909309296 1:74125828-74125850 CTTTTTCTGATTCTTTTATCAGG + Intronic
909637462 1:77833052-77833074 GTATTTCTAAATGTTCTATCTGG - Intronic
909795823 1:79734650-79734672 CTATTTCTGATTCATCAATCTGG + Intergenic
909869426 1:80720742-80720764 CTTTGTCTGGATTTGCTATCAGG + Intergenic
912962704 1:114210135-114210157 CTAGTCCTGGATCTGCCATCTGG + Intergenic
915050400 1:153065035-153065057 CTTTGTCTGGATTTTCTATCAGG - Intergenic
915828352 1:159102481-159102503 CTGTTTGTGGATCTACTTTCTGG - Intronic
917468061 1:175300848-175300870 TTCTTTCTTGATCTTCTTTCTGG - Intergenic
918734237 1:188038161-188038183 CTGTTGCTGGATCTACCATCTGG - Intergenic
919269578 1:195322238-195322260 ATATTACTGGAAGTTCTATCTGG - Intergenic
919279817 1:195475198-195475220 CTATTTCTGGGTCCTCTATTTGG - Intergenic
919307318 1:195858379-195858401 ATATTTCTGGATGTTCCATTTGG - Intergenic
919310820 1:195905511-195905533 CTTTTTGTAGATGTTCTATCAGG + Intergenic
919593623 1:199534709-199534731 CTATTTCTGGACTCTCTATTCGG + Intergenic
919742766 1:200990705-200990727 CTTCTTCTGGAACTTCTTTCTGG + Exonic
921879766 1:220242791-220242813 GTATTTTTGGATCTTCTGTTTGG - Intronic
1064081201 10:12309247-12309269 ATGTTTTTGGATCATCTATCTGG + Intergenic
1065711149 10:28519298-28519320 TTATTGCTGCATCTTCTATAGGG - Intergenic
1066505605 10:36039279-36039301 CTACTTCTGGATCTTTTCCCAGG + Intergenic
1066556265 10:36617641-36617663 CTATTTTTAGATCTTATACCAGG + Intergenic
1066593506 10:37022326-37022348 ATATTAGTGGATCTTCTCTCTGG + Intergenic
1068502468 10:57857474-57857496 CTCTTTCTGGTTTTGCTATCAGG + Intergenic
1068945694 10:62726597-62726619 CCATTTTTGGATCATCTATTGGG - Intergenic
1069252721 10:66290693-66290715 CTATTTCTGTATGTCATATCAGG - Intronic
1070035802 10:72722712-72722734 CTATTTCTTAATCATCTAACAGG - Intronic
1070755563 10:78990460-78990482 TTATTTCTGGATTTTGTATTGGG - Intergenic
1072213609 10:93269629-93269651 CTATTTCTGGAAGTTCTATTTGG - Intergenic
1079141919 11:17816754-17816776 CTGATTCTGGATCTTGTCTCAGG - Intronic
1079429361 11:20374164-20374186 CTATTTCTTGATCTTGGAACTGG + Intronic
1079511015 11:21210513-21210535 CCATTTCTGTATCTTCTTTGGGG + Intronic
1080141080 11:28920989-28921011 CTTTTTCTCCATCTTTTATCAGG + Intergenic
1081685511 11:45040266-45040288 CTAATTCTGGGTTTTCCATCTGG - Intergenic
1082797700 11:57389910-57389932 TTACTTCTGGCTCTTCTATTTGG - Exonic
1083369789 11:62169450-62169472 GGATTTCTGGATGTTCTCTCTGG - Intergenic
1085425491 11:76400937-76400959 TTATTTCTGGAAGTTCTATATGG + Intronic
1086517429 11:87628915-87628937 CTTCTTCTGTATCTTCTATATGG + Intergenic
1087358843 11:97131544-97131566 CTTTTTCTGGTTTTTGTATCAGG + Intergenic
1088201526 11:107340486-107340508 CTATTTCTGGGTTGTCTATTTGG + Intronic
1090317942 11:125813295-125813317 CTTTGTCTGGTTCTGCTATCAGG + Intergenic
1090468737 11:126959301-126959323 CTATCTCTGTATTATCTATCTGG + Intronic
1090581302 11:128162887-128162909 GTATTTCTGGATATTATACCTGG - Intergenic
1090801964 11:130178725-130178747 ATATTTCTGGATCTTCCTTGGGG + Intronic
1091190442 11:133690079-133690101 CTTTTTCTGGTTTTTGTATCAGG - Intergenic
1092294111 12:7184653-7184675 CTGCTGCTGGATCATCTATCTGG - Intergenic
1095184448 12:39185665-39185687 CTATTTCTGTAGATTTTATCTGG + Intergenic
1095744536 12:45643002-45643024 TTATTTCTGGATATTCTATTTGG + Intergenic
1096428509 12:51523971-51523993 CAATTTCTGTATCTTGTATTAGG + Intergenic
1096554152 12:52393184-52393206 TTATTTATGAATCTTCTCTCCGG + Intergenic
1098032777 12:66271504-66271526 CCATTTCTGTGTCCTCTATCTGG + Intergenic
1100416756 12:94385737-94385759 TTATTTCTGAATCTTCATTCTGG + Intronic
1101747905 12:107558146-107558168 CTATCTCTGGATTTCCTACCTGG - Intronic
1101889627 12:108701543-108701565 CTGTTTCTGGATCTTGAATTAGG - Intronic
1108247699 13:48533493-48533515 CTATTGCTGGCCCCTCTATCTGG + Intergenic
1108956039 13:56158419-56158441 TTATTTGTTGATTTTCTATCTGG - Intergenic
1109022935 13:57121086-57121108 TTATTTCTAGATTTTATATCAGG - Intergenic
1109941344 13:69370139-69370161 TTATTTCTGGATTCTCTATTTGG - Intergenic
1110795858 13:79637300-79637322 CTATTTCTGGTTCTCTTTTCTGG - Intergenic
1110886878 13:80650438-80650460 CTATTTCTCTATTTTCTATCAGG + Intergenic
1111100807 13:83583578-83583600 CTTTATCTGGTTTTTCTATCAGG + Intergenic
1111110914 13:83708138-83708160 CTTTTTCTGGATATTCTGTCTGG + Intergenic
1115960655 14:38833474-38833496 CTCTTCTTTGATCTTCTATCTGG - Intergenic
1116497495 14:45580095-45580117 TTATTTGTGGATTTTCTGTCTGG + Intergenic
1117507877 14:56420500-56420522 CTATAGCTGGATCTTCTGTCTGG + Intergenic
1118123146 14:62868472-62868494 CTATTTTTGGATTTTCTTTATGG + Intronic
1119578636 14:75753636-75753658 CAATTTCATGATCTACTATCAGG + Intronic
1121362688 14:93276341-93276363 CAATCTCTGGATTATCTATCTGG + Intronic
1122756836 14:103987792-103987814 CTACTTCTTGATCTTCTGCCTGG + Intronic
1123185615 14:106513829-106513851 CTTCCCCTGGATCTTCTATCTGG + Intergenic
1124091150 15:26602352-26602374 TTCTTTGTTGATCTTCTATCGGG - Intronic
1128787527 15:70409140-70409162 CTATTTCTGCTTCTTCTAGCAGG + Intergenic
1128851378 15:70960602-70960624 CTATTTCTGGGCCTTTTATTTGG - Intronic
1131451842 15:92547792-92547814 CTAATTCAGGATCATCTATCTGG - Intergenic
1137029804 16:35511739-35511761 CTATCTCTGGTTTTTGTATCAGG - Intergenic
1138156880 16:54714015-54714037 CTGTTTCTGTACCTTCTATTTGG + Intergenic
1139724753 16:68888143-68888165 CTATATATGTACCTTCTATCTGG + Intronic
1140719496 16:77758532-77758554 CTAGTTCTGGATCTAGTCTCTGG + Intergenic
1143197997 17:5091188-5091210 CTAAATCTGGATCTTCTCTTTGG + Intronic
1143800055 17:9371733-9371755 TTATTTCTAGAAGTTCTATCTGG + Intronic
1146748318 17:35352206-35352228 CCATTTCTGGCTCTCCTTTCAGG - Exonic
1146756867 17:35440429-35440451 CCATTTCTGGCTCTCCTTTCAGG - Exonic
1147010818 17:37446008-37446030 CTATTTCTTTATCTTAGATCTGG - Intronic
1147683444 17:42270832-42270854 CCATTTCTTCATCTTCCATCTGG + Intronic
1151212582 17:72555632-72555654 CTATTTGGAGTTCTTCTATCAGG - Intergenic
1153425979 18:4964024-4964046 TTATTTGTTGATTTTCTATCTGG - Intergenic
1156029101 18:32691544-32691566 CTATTTTTGCATCTTCTTTGGGG - Intronic
1156816093 18:41313161-41313183 ATATTTCTAGATCTTCAAACTGG - Intergenic
1156944396 18:42811169-42811191 CTCTTTCTAGATCTTTTATTTGG - Intronic
1158106728 18:53893868-53893890 CTATTTCTGGACCTTCCTACCGG - Intergenic
1159012456 18:63070917-63070939 GTGTTTCTGGATCTTGTACCTGG + Intergenic
1161588023 19:5115912-5115934 CTTTTTCTGAAACTCCTATCAGG - Intronic
1162950668 19:14070555-14070577 GGATTTCTGGATGTTCTCTCTGG - Intergenic
1165544458 19:36522686-36522708 CAATTCCTCCATCTTCTATCTGG + Intronic
926082152 2:9995948-9995970 CTCTCTTTGGTTCTTCTATCCGG - Exonic
927378450 2:22447720-22447742 CTTCTTATGGAACTTCTATCAGG - Intergenic
927607156 2:24495993-24496015 TTATTTCTGGTTCTGCAATCTGG + Intronic
930291281 2:49496268-49496290 TTATTTATGGATTTTCTATTCGG - Intergenic
932499405 2:72170200-72170222 CTATTTCTGGATTTTCTTTATGG - Intergenic
933121653 2:78545754-78545776 CTTTTTCTGGATTTTTTATCAGG - Intergenic
933348233 2:81118431-81118453 ATCTTTCTGGATTTTCTATTTGG - Intergenic
933525008 2:83426116-83426138 TTATTTCTGGAACTCCTATTAGG + Intergenic
934539589 2:95162793-95162815 CAATTTCTGGATCCTCAATTGGG - Intronic
936289575 2:111210838-111210860 CTATTTCTGGACTTTCTATTTGG + Intergenic
936418152 2:112338369-112338391 CTAATTTTGGGTCTTGTATCTGG + Exonic
937628504 2:124070792-124070814 TTCTTTCTTGATTTTCTATCTGG - Intronic
942215149 2:173712167-173712189 GTATTTCTGGACCATATATCAGG - Intergenic
942233930 2:173885887-173885909 TTATTTCTGTATTATCTATCTGG - Intergenic
943845352 2:192638237-192638259 TTCTTTGTGGATTTTCTATCTGG - Intergenic
945757148 2:213860986-213861008 CTATAAATGTATCTTCTATCCGG + Intronic
946635626 2:221722389-221722411 TTATTTCTTGATTTTCTATTTGG + Intergenic
948554899 2:238802217-238802239 CTCTTTCTAGAACTTCTATGAGG - Intergenic
1168984155 20:2033459-2033481 GTATCTCTGGGTCTTCTCTCCGG - Intergenic
1170275925 20:14588019-14588041 CTTTTTCTGGATCTGGTATCAGG + Intronic
1171558704 20:26100681-26100703 TTATTTCTGGAACTTCTGTTTGG - Intergenic
1174939343 20:54907318-54907340 CTTTTTCTGGTTTTTGTATCAGG - Intergenic
1175530497 20:59671584-59671606 CAATATCTGGATTTTCTTTCTGG + Intronic
1176652309 21:9561941-9561963 TTATTTCTGGAATTTCTATTTGG + Intergenic
1177597076 21:23258433-23258455 TAATTTCTGGATCCTCCATCAGG + Intergenic
1178041624 21:28646268-28646290 CTATTTATGGGTTATCTATCAGG - Intergenic
1178237482 21:30859242-30859264 CTTTTTCTGTTTCTTCTTTCTGG + Intergenic
1178498480 21:33106656-33106678 CTTTTTCTTGCTCTTCTCTCTGG - Intergenic
1178780487 21:35598598-35598620 CTATTTCTGGATGTTCACTCAGG - Intronic
1182201629 22:28577514-28577536 TTATTTGTGGATTTTCTGTCTGG + Intronic
1182356467 22:29724377-29724399 CTTCTTCTGGCTCTGCTATCTGG + Intronic
1183029836 22:35095309-35095331 CTACATCTGTCTCTTCTATCAGG + Intergenic
949225903 3:1695616-1695638 ATATTTCTGGATTTTATATTTGG - Intergenic
949482082 3:4503588-4503610 ATATTTTTGGTTGTTCTATCTGG + Intronic
951340680 3:21482854-21482876 CTATTTTTGCAACTTCTATGTGG - Intronic
951919660 3:27840571-27840593 CACTTTCTGGTCCTTCTATCTGG - Intergenic
953338116 3:42111140-42111162 CTCCTTCTGGACCTTCTGTCTGG - Intronic
953408862 3:42676681-42676703 CTATTTCTGGGTCCTCTGTTCGG + Intergenic
954603591 3:51891791-51891813 CAATTTCCGGATCTTCTCTGTGG + Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
955981032 3:64528218-64528240 CTATTCCAGAATCTTCTACCTGG + Intronic
956587239 3:70877909-70877931 CTGTTTCTGTCTCTTTTATCAGG + Intergenic
956994984 3:74815970-74815992 CTATTTCTGGGTCTACTTTGTGG + Intergenic
957609164 3:82445075-82445097 TTCTTTATGGATCTTCTATCAGG + Intergenic
958568111 3:95841662-95841684 TTCTTTCTTGATCTTCTCTCTGG + Intergenic
958687349 3:97416238-97416260 ATAATTCTGGATCTGCTGTCAGG - Intronic
959447127 3:106454301-106454323 CATTTTCTGGATCTTCTCCCTGG + Intergenic
961021454 3:123510565-123510587 CTATGTCTGGTTCATCTATGTGG + Intronic
963354546 3:144194624-144194646 TTATTTGTGGATTTTCTGTCTGG + Intergenic
964151127 3:153525812-153525834 TTATTTCAGTATCTTCTATCTGG + Intergenic
964520135 3:157556678-157556700 CTTTGTCTGGCTCTGCTATCAGG - Intronic
964572896 3:158129664-158129686 CTATTTCTGGATTGTTTATTTGG + Intronic
966515188 3:180812418-180812440 CTATTTCTGTATCTTATTTGTGG - Intronic
966649586 3:182284759-182284781 GTATTTATGGGTCTTCCATCGGG + Intergenic
966858507 3:184213740-184213762 ATTTTTGTAGATCTTCTATCTGG + Intronic
968880769 4:3298261-3298283 CTCTTTCTGGAACTTTTATTTGG + Intronic
970632785 4:17970191-17970213 CTATTTCTGGATCTTCTATCTGG - Intronic
970750707 4:19356189-19356211 CTTTGTCTGGATTTGCTATCAGG - Intergenic
970801110 4:19974834-19974856 CTATTTCTTGTTCTCCTACCAGG + Intergenic
970911150 4:21277156-21277178 CTATCTGTGGATCTTTTCTCTGG - Intronic
971060280 4:22960474-22960496 CTCTTTCTTGATCTTGTCTCAGG + Intergenic
971191325 4:24431586-24431608 GTCTTTCTGGTTCTTCTCTCTGG - Intergenic
971954026 4:33392741-33392763 CTATTTCTGGATCTGTATTCAGG - Intergenic
973862818 4:55082550-55082572 TTACTTCTGGTTCTTCTAACGGG + Exonic
975566660 4:75763102-75763124 ACATTTCTGGATCTTCTCTTTGG - Intronic
975849863 4:78561110-78561132 CTTTTTCGGTATCTTCTATATGG - Intronic
977900886 4:102421165-102421187 CAAATACTGGATCATCTATCTGG - Intronic
980213458 4:129819947-129819969 TTATTTCTGCATTTTCTATTTGG + Intergenic
980289094 4:130822349-130822371 CTATTTCTGGGTTTTCTATTTGG + Intergenic
980610548 4:135155598-135155620 TTATTTCTGGACTTTCTATCCGG - Intergenic
981438041 4:144749420-144749442 CTTTTTCTGTTTCTTCCATCTGG + Intergenic
982176094 4:152706939-152706961 CTATCGCTGGAACTCCTATCTGG - Intronic
984510260 4:180670293-180670315 CTAATTGTGGATCTTCAACCTGG + Intergenic
985126705 4:186701825-186701847 ATGTTTCTGGAGCTTCTGTCTGG - Intronic
985300474 4:188483023-188483045 TTATTTCTGGATTATCTATTTGG + Intergenic
985668926 5:1196515-1196537 CTATTTCTAGATATTTTCTCAGG + Intergenic
989672903 5:43939527-43939549 ATGTTTCTTGATTTTCTATCTGG - Intergenic
990428974 5:55716333-55716355 TTTTTTGTTGATCTTCTATCTGG - Intronic
992581564 5:78183536-78183558 CTATTTCTGTATTTTTTACCAGG - Intronic
993148009 5:84121241-84121263 CTAATTCAGAAGCTTCTATCTGG + Intronic
994243489 5:97451163-97451185 CTTTTTGAGGATATTCTATCAGG - Intergenic
994628044 5:102245635-102245657 TTCTTTCTTGATATTCTATCTGG - Intronic
994772823 5:104005128-104005150 CTATGTCAAGATCTTATATCGGG - Intergenic
996320917 5:122215114-122215136 CTGTTTATTGATCTTCTGTCTGG - Intergenic
996397096 5:123024428-123024450 CCATTTCTGAATCTGCTTTCTGG - Intronic
996978856 5:129464729-129464751 ATCTTTCTGGATCTCATATCTGG + Intronic
998214009 5:140223756-140223778 CTATTTCTGGAGCTGATATGAGG + Intronic
1001593780 5:172884764-172884786 CTGTTGCTGGATCTTCTCTATGG + Intronic
1002681908 5:180971362-180971384 CTATTTCTTGATTTTCTGCCTGG - Intergenic
1009591809 6:65682204-65682226 CTATTACTGCAGCTTCTACCTGG - Intronic
1010360633 6:74988456-74988478 CTATTTCTGGATCTTATTTCTGG - Intergenic
1012117008 6:95313506-95313528 TTATTTCTGGGTCCTCTATTCGG - Intergenic
1012702983 6:102486780-102486802 GTATGTCTGGTTCTTCTTTCTGG - Intergenic
1013485570 6:110593332-110593354 CTATCTCTGGATTTCCTTTCTGG - Intergenic
1013847158 6:114467113-114467135 ATATTTGTGGAACTTCAATCTGG - Intergenic
1015221988 6:130814388-130814410 CTCTTTCTTCATCCTCTATCTGG + Intergenic
1016567882 6:145477442-145477464 CTTTTTCTGGTTTTGCTATCTGG - Intergenic
1018150780 6:160935673-160935695 TTATTTCTGGATTCTCTATTTGG + Intergenic
1018349306 6:162940062-162940084 CTTTTTCTGGATCATGGATCAGG + Intronic
1020574589 7:9910293-9910315 TTCTTTGTTGATCTTCTATCTGG + Intergenic
1021039513 7:15844518-15844540 CTACTTCTTGATCTCCTGTCTGG - Intergenic
1021386589 7:20038509-20038531 TCATTTCTGGATCTGCTACCTGG + Intergenic
1022151954 7:27617517-27617539 CTAATTTTGGCTCTTCTTTCTGG - Intronic
1022376525 7:29817170-29817192 CTATTTGTGTATTTTCTATCGGG + Intronic
1022955429 7:35375981-35376003 CTTTTTCTGGTTCTTCTCTTTGG - Intergenic
1023548624 7:41345085-41345107 CTTTTTCTGGATGGTATATCAGG + Intergenic
1025751771 7:64300082-64300104 TTATTTCTGGATCTTTCTTCAGG - Intergenic
1026803683 7:73416157-73416179 CTCTTTCTGGAATTTCTATTAGG - Intergenic
1027813265 7:82933087-82933109 TCATTTCTGGATCTTGAATCAGG - Intronic
1027948596 7:84782577-84782599 TTATTTCTGGACTTTCTATTTGG - Intergenic
1028736334 7:94216966-94216988 CTGTTTCACCATCTTCTATCAGG - Intergenic
1029816399 7:103100465-103100487 GTATTTGTGCATCTTCTTTCTGG - Exonic
1030741627 7:113116542-113116564 ATATTTCTAGATTTTCTATCAGG + Intergenic
1031915958 7:127563485-127563507 CTCTTGCTGTATCTTCTACCTGG - Intergenic
1032163559 7:129528400-129528422 CTATTTCTGGTTCTCCTCTGGGG - Intergenic
1032516785 7:132512383-132512405 CTCATTCTGCATCTTCTATTAGG + Intronic
1032788722 7:135224743-135224765 CTTTGTCTGGATTTTGTATCAGG - Intergenic
1033856727 7:145570993-145571015 CTATTTCTAGATATTCTATTTGG + Intergenic
1033882217 7:145899729-145899751 TTTTTTGTTGATCTTCTATCTGG + Intergenic
1037269059 8:17105428-17105450 CTATTTCTAGAACTTCTGTTTGG - Exonic
1039203829 8:35127202-35127224 CTATTTTGGGATTTTCTATTTGG - Intergenic
1041561232 8:59221047-59221069 CTATTTCTGGATATTATTTTTGG - Intergenic
1042726567 8:71885180-71885202 TTATTTGTTGATTTTCTATCTGG + Intronic
1042938279 8:74082252-74082274 CTCTTTCTTTATCTTCTTTCTGG + Intergenic
1044563187 8:93633819-93633841 TTATTTCTGTTTCTTCCATCAGG - Intergenic
1045919110 8:107509542-107509564 ATATTTCTGTATCTTGGATCTGG - Intergenic
1046365472 8:113225292-113225314 CTTTTTCTGAATGTTCTTTCTGG - Intronic
1046749345 8:117910558-117910580 CTATTTCATGATTTTCTCTCTGG - Intronic
1049618327 8:143586228-143586250 GGATTTCTGGATGTTCTCTCTGG + Exonic
1051268639 9:15333272-15333294 CTATTTCTGAAGCTTCTTGCTGG - Intergenic
1055015043 9:71607366-71607388 CTTTTTCTAGATCTTCTCTTTGG - Intergenic
1055389831 9:75808530-75808552 ATATTTATGCATCTTCTACCTGG + Intergenic
1056608609 9:88109216-88109238 CTATTTCTCGATATTGCATCCGG - Intergenic
1056769877 9:89469442-89469464 CTTTTTCTGGATTTGCTATCAGG - Intronic
1057155759 9:92837489-92837511 GGATTTCTGGATGTTCTCTCTGG + Intergenic
1060040360 9:120295190-120295212 TTCTTTCTGAATCTCCTATCTGG - Intergenic
1060092797 9:120759030-120759052 CTGTTTCTGCATCTTCTAGAAGG - Exonic
1060710618 9:125860213-125860235 CAACTTCTGGATGTTTTATCTGG + Intronic
1203630038 Un_KI270750v1:65487-65509 TTATTTCTGGAATTTCTATTTGG + Intergenic
1186601876 X:11047390-11047412 ATGTTTCTGGATCTTTTATTGGG + Intergenic
1187196816 X:17094560-17094582 CTCTTTGTGGATCTTTTATTTGG + Intronic
1187513837 X:19947396-19947418 CTATTTCTGCCTTTTCTAACTGG - Intronic
1188379628 X:29475057-29475079 ATATTTCTGGAGCATCTAACAGG - Intronic
1188650735 X:32629074-32629096 TTATGTCTGGATGATCTATCTGG + Intronic
1192163898 X:68811089-68811111 CTTTGTCTGGTTCTGCTATCAGG - Intergenic
1193286080 X:79716856-79716878 CTATTCATGGCTCTTCTATATGG - Intergenic
1193853619 X:86571254-86571276 CTATTTCTGGACCCTCTATTAGG + Intronic
1194495050 X:94604504-94604526 ATTTTTCTGGGTCTTCTCTCTGG - Intergenic
1194587234 X:95750634-95750656 CTAATTTTGGATCTTCCATGTGG - Intergenic
1196577645 X:117338778-117338800 CTTTTTCTGGTTTTTGTATCAGG + Intergenic
1197039690 X:121921547-121921569 CTATTTCTGTATCTTCTCTTTGG - Intergenic
1199601610 X:149544503-149544525 CTATTTCTGACTGTTCTATTAGG + Intronic
1199640398 X:149855434-149855456 CTTTTTATGGGTCTTTTATCAGG + Intergenic
1201632540 Y:16084984-16085006 CTTTTTGAGGATCTTCTTTCAGG - Intergenic