ID: 970635966

View in Genome Browser
Species Human (GRCh38)
Location 4:18009788-18009810
Sequence CTCCATTGGAAGGCATGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
970635966_970635973 14 Left 970635966 4:18009788-18009810 CCTTAGCATGCCTTCCAATGGAG 0: 1
1: 0
2: 0
3: 8
4: 77
Right 970635973 4:18009825-18009847 CTTCATTCCATCAACCCCCATGG 0: 1
1: 0
2: 0
3: 17
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
970635966 Original CRISPR CTCCATTGGAAGGCATGCTA AGG (reversed) Intronic
906556478 1:46718516-46718538 CTCCATTGGAAATCTTGCTCCGG - Exonic
908443533 1:64179077-64179099 CTCCATTGGAGTGCATGACATGG + Exonic
908610180 1:65849443-65849465 CTCCATTGGGAAGCATCCTGAGG + Intronic
908668581 1:66520165-66520187 CACCTTTGCAAGGGATGCTATGG + Intergenic
913374404 1:118134670-118134692 CTCCTTAGCAAGGCATACTAGGG + Intronic
915579838 1:156806945-156806967 CTGCATTGGAAAGGATGTTAAGG - Intronic
918813423 1:189150290-189150312 CTCCATTGGACGTCCTGCTAGGG + Intergenic
1071061468 10:81574929-81574951 CTCCATTGGCTGGCTTGCTCAGG - Intergenic
1071561996 10:86652144-86652166 CTCCATTGGATGGCAGGCTCCGG + Intergenic
1072008538 10:91282628-91282650 CTCCTTGGGAACTCATGCTATGG + Exonic
1076104870 10:127813655-127813677 CACCCTTGTGAGGCATGCTAGGG - Intergenic
1077029131 11:455850-455872 CTCCACTGGAAGGAAGGCTCAGG + Intronic
1079929009 11:26534099-26534121 CTGCATTGGAAAGCATGGTATGG + Intronic
1082171393 11:49009632-49009654 CTACTTTGGAATGCATGCAAGGG + Intergenic
1086694498 11:89827459-89827481 CTACTTTGGAAAGCATGCAAGGG - Intergenic
1086711647 11:90017052-90017074 CTACTTTGGAAAGCATGCAAGGG + Intergenic
1092370841 12:7915693-7915715 CTGCATTGGAAGGCAGGTCAAGG + Intergenic
1094228389 12:28073743-28073765 CTCCTCTGGATGGCATTCTATGG + Intergenic
1097805564 12:63961271-63961293 CTCCATTGGACAGCATGCTTAGG + Intronic
1097959352 12:65517331-65517353 ATCCAGTGGAAGGGATGCTTGGG + Intergenic
1109228556 13:59727047-59727069 CCCCATTGAAAGACATGATAAGG - Intronic
1115509148 14:34122879-34122901 CTCCATTGGAAAACATCCTAAGG + Intronic
1117818135 14:59619629-59619651 CTCCAATGGAGGGTAGGCTAAGG + Intronic
1117954058 14:61109270-61109292 CACCTGTGGAAAGCATGCTAAGG + Intergenic
1118035311 14:61859852-61859874 ATCCATTTGAAGGCATCTTAAGG + Intergenic
1119071889 14:71594485-71594507 CTGAATTGTAAGGCATTCTATGG - Intronic
1123973644 15:25532060-25532082 CTCCTTTGGAACGCATGCCTGGG + Intergenic
1125030291 15:35069364-35069386 GTGCATTGGAAGGCACGCTTTGG - Intergenic
1125865186 15:43040760-43040782 CTCCATTGAAAAGCAGGCGAAGG + Intronic
1128706176 15:69838857-69838879 CTTCATTCGAAGGGTTGCTATGG - Intergenic
1133281939 16:4671541-4671563 CTCCAGGGGAAGGCATGGAAGGG - Intronic
1134844888 16:17431716-17431738 ATCCATTCGAAGGCAGGCCATGG + Intronic
1137888237 16:52129444-52129466 CCCCATTGGAAGGGATGCCTAGG - Intergenic
1138282822 16:55785008-55785030 CTCCACAGGCAGGCATGTTAAGG + Intergenic
1140119060 16:72067676-72067698 TTCCCTTAGAGGGCATGCTAGGG + Intronic
1140265293 16:73415569-73415591 ATACATTGGAGGGAATGCTAAGG - Intergenic
1142108484 16:88318752-88318774 CTCCCTTGGAAAGCATGCGAGGG + Intergenic
1144005253 17:11093934-11093956 CTCCATTGGCAGGAAAGCTGGGG - Intergenic
1149065940 17:52479322-52479344 CTTCATTGGAAGGGGTCCTATGG + Intergenic
1155495817 18:26440543-26440565 CTCCCATGGAAGGCATCCCACGG - Intergenic
1158307807 18:56125710-56125732 CTCCATGGGATGGAAGGCTATGG + Intergenic
942865667 2:180671535-180671557 CTCCATTAGAAGGTGGGCTAAGG - Intergenic
947311077 2:228803068-228803090 GTCCACTGGACGGCATGCTCAGG + Intergenic
1175658702 20:60793783-60793805 CTCCCTGGGAAGGCAACCTAAGG + Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176922521 21:14705281-14705303 CTCCTTAGGAAGCCATGCAAGGG + Intergenic
1176981402 21:15385352-15385374 TTCCATTAGAAGGCATGGTCAGG + Intergenic
1178195751 21:30343924-30343946 CTCCCTTGCAAGGCATGCAATGG + Intergenic
1181544246 22:23592066-23592088 CTCCAGCGGAAGGCATGTTCAGG + Intergenic
951245346 3:20334930-20334952 CTCTATTGGAAGGTATTATAAGG + Intergenic
952816296 3:37451008-37451030 CTCCATGTGAAGTTATGCTAAGG + Intergenic
952906157 3:38140333-38140355 CTCCATGGGAAGGCTTGGGAGGG - Intronic
958632363 3:96700361-96700383 CCCCCTTGCAGGGCATGCTATGG - Intergenic
960330284 3:116351282-116351304 CTCCATTGGAAGGTAGGGTGTGG - Intronic
964512697 3:157470427-157470449 GTCCATTGAAAAGCATGCAAAGG - Exonic
965326078 3:167306343-167306365 CTTTATTGCTAGGCATGCTAGGG - Intronic
970198811 4:13580515-13580537 ATCCATTGAAATGCATGCGATGG + Intronic
970635966 4:18009788-18009810 CTCCATTGGAAGGCATGCTAAGG - Intronic
971380917 4:26096934-26096956 CTCCATTAGACAGCATGGTAAGG + Intergenic
972429175 4:38964176-38964198 ATCCTTTGAAAGGCAGGCTAGGG + Intergenic
979074981 4:116259887-116259909 CTCAATTGGAAGACTTGCAAGGG + Intergenic
980754396 4:137138459-137138481 CTCCCGTGGAAAGCATGATATGG + Intergenic
985030418 4:185783674-185783696 CTCCAGTGGCAGGCATGAGAGGG + Intronic
986383273 5:7207615-7207637 CACCATTGAAATTCATGCTATGG + Intergenic
1000822252 5:165999042-165999064 CTTCATTGAGAGTCATGCTATGG + Intergenic
1006708753 6:36046909-36046931 CTCCATTGGTAAGCCTGCTGGGG - Intronic
1011003371 6:82616610-82616632 CTCAATTGGAAGAAACGCTAAGG + Intergenic
1011212283 6:84967534-84967556 CTCCACTGGAAGCTTTGCTAAGG + Intergenic
1022524792 7:31029888-31029910 CTCCATTCGATGGCACCCTAGGG - Intergenic
1026766981 7:73166259-73166281 ATCCATTGGAAGGCTTGCCTGGG - Intergenic
1027043466 7:74975995-74976017 ATCCATTGGAAGGCTTGCCTGGG - Intronic
1027080180 7:75226364-75226386 ATCCATTGGAAGGCTTGCCTGGG + Intergenic
1029389389 7:100264971-100264993 ATCCATTGGAAGGCTTGCCTGGG + Intronic
1033563895 7:142560187-142560209 CTCCTATGTAAGGCATGTTATGG + Intergenic
1037000611 8:13714137-13714159 CTCTCTAGGAAGGCATGCAAGGG - Intergenic
1045970210 8:108071548-108071570 CATCAGTGGAAGGAATGCTATGG + Intronic
1047440014 8:124869567-124869589 CTTCATTGGAAGGCGTGAAAAGG + Intergenic
1060171887 9:121468756-121468778 CTCCATTGGCAAGGGTGCTAAGG + Intergenic
1062550044 9:137081992-137082014 CTCCATTTGGGGGCAAGCTAGGG - Exonic
1186084156 X:5968313-5968335 CTCCATTAAAGGGCATGCTGTGG + Intronic
1186566451 X:10667846-10667868 TTCCATTTGAATGCATGCTATGG - Intronic
1197177888 X:123504246-123504268 CTCCATTGTAAGTGATGCTTTGG - Intergenic
1200824901 Y:7627368-7627390 CTCCTCTGGAAGGCAGGATATGG - Intergenic
1202235154 Y:22703719-22703741 CTCCTCTGGAAGGCAGGATATGG + Intergenic
1202308005 Y:23492449-23492471 CTCCTCTGGAAGGCAGGATATGG - Intergenic
1202562796 Y:26178137-26178159 CTCCTCTGGAAGGCAGGATATGG + Intergenic